Pp20Cl, Pp20Cl (genetic_marker) Prunus persica

Marker Overview
NamePp20Cl
dbSNP IDN/A
SNP Array ID
IRSC 16K SNP array for peach:Pp20Cl
IRSC 9K SNP array for peach:Pp20Cl
TypeSNP
SNP Alleles[A/G]
SpeciesPrunus persica
Primer 1Pp20Cl_LEFT_primer_0: CAGTTGATTGAGATCGACCTTG
Primer 2Pp20Cl_RIGHT_primer_0: CTTCATCTGTGAGTTGGTCAGC
Product Length247
ContactKsenija Gasic
Contact
NameDetails
Ksenija Gasic
Description:fruit quality, abiotic and biotic tolerance /resistance
First name:Ksenija
Last name:Gasic
Title:Assistant professor
Institution:Clemson University
Address:112 BRC/ 51 New Cherry Rd, Clemson Sc 29634
Country:USA
Email:kgasic@clemson.edu
Phone:864.656.3664.
Fax:864-656-4960
Keywords:Traditional and molecular plant breeding
Analyses
This genetic_marker is derived from or has results from the following analyses
Analysis NameDate Performed
RosBREED SNP development2011-01-01
Alignment of IRSC SNP array 9K to Peach Genome v2.0.a12016-11-21
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Pp20Cl_LEFT_primer_0Pp20Cl_LEFT_primer_0Prunus persicaprimer
Pp20Cl_RIGHT_primer_0Pp20Cl_RIGHT_primer_0Prunus persicaprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
Pp20ClPp20Cl-13.3Prunus persicamarker_locus
Pp20ClPp20Cl-11.316Prunus persicamarker_locus
Pp20ClPp20ClPrunus persicamarker_locus


Sequence
>Pp20Cl ID=Pp20Cl|Name=Pp20Cl|organism=Prunus persica|type=genetic_marker|length=101bp
CGGAGAAATTAATGCTAAAGAAGCTAGACGACATCGTTCAGACCATCCTC
RTCCAGAGGGCCACTCCCGATTGGCTCCCCTTCGTTCCCGGCTCCTCGTT
C
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Peach_Consensus_map_20181N/A13.3Pp20Cl-13.3View
2Peach-ZC-F2-20181N/A11.32Pp20Cl-11.316View
3Peach-WB-F2-2015LG1N/A14.72Pp20ClView
4Prunus-TE-F2-20151N/A5.2Pp20ClView
5Peach-DvsS-BC2LG1N/A10Pp20ClView
6Peach-PF-Recurrent-2017LG1N/A7.5Pp20ClView
Alignments
Feature NameTypeLocationAnalysis
scaffold_4 supercontig scaffold_4:16485285..16485285. Prunus persica Whole Genome v1.0 Assembly & Annotation
Pp01 chromosome Pp01:5483781..5483781. Prunus persica Whole Genome Assembly v2.0 & Annotation v2.1 (v2.0.a1)