SNP_IGA_10635, SNP_IGA_10635 (genetic_marker) Prunus persica

Marker Overview
NameSNP_IGA_10635
AliasSA10635
dbSNP IDN/A
SNP Array ID
IRSC 16K SNP array for peach:SNP_IGA_10635
IRSC 9K SNP array for peach:SNP_IGA_10635
TypeSNP
SNP Alleles[A/G]
SpeciesPrunus persica
Primer 1SNP_IGA_10635_LEFT_primer_0: GTGACTTTTATGAAGCCCTTGG
Primer 2SNP_IGA_10635_RIGHT_primer_0: CTGAATGTGAGGCAGAATGAAA
Product Length214
Publication[view all]
ContactPere Arus
Ksenija Gasic
Contact
NameDetails
Pere Arus
First name:Pere
Last name:Arus
Title:Researcher
Institution:IRTA
Address:IRTA, Centre de Recerca en Agrigeno`mica CSIC-IRTA-UAB-UB; Campus UAB, Bellaterra (Cerdanyola del Valle`s), 08193 Barcelona, Spain
Country:Spain
Email:pere.arus@irta.cat
Ksenija Gasic
Description:fruit quality, abiotic and biotic tolerance /resistance
First name:Ksenija
Last name:Gasic
Title:Assistant professor
Institution:Clemson University
Address:112 BRC/ 51 New Cherry Rd, Clemson Sc 29634
Country:USA
Email:kgasic@clemson.edu
Phone:864.656.3664.
Fax:864-656-4960
Keywords:Traditional and molecular plant breeding
Analyses
This genetic_marker is derived from or has results from the following analyses
Analysis NameDate Performed
RosBREED SNP development2011-01-01
Alignment of IRSC SNP array 9K to Peach Genome v2.0.a12016-11-21
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
SNP_IGA_10635_LEFT_primer_0SNP_IGA_10635_LEFT_primer_0Prunus persicaprimer
SNP_IGA_10635_RIGHT_primer_0SNP_IGA_10635_RIGHT_primer_0Prunus persicaprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
SNP_IGA_10635SNP_IGA_10635-8.99Prunus persicamarker_locus
SNP_IGA_10635SNP_IGA_10635-7.15Prunus persicamarker_locus
SNP_IGA_10635SNP_IGA_10635Prunus persicamarker_locus
SNP_IGA_10635SNP_IGA_10635Prunus spp.marker_locus
SA10635SA10635Prunus spp.marker_locus


Sequence
>SNP_IGA_10635 ID=SNP_IGA_10635|Name=SNP_IGA_10635|organism=Prunus persica|type=genetic_marker|length=121bp
TATTTTGGTTGAATATGCAGGTTTGAATCCTTTTGGTGGCCTGCGTTCAG
ATAGCATTCCRAGAGCTGGATGCCCGGTTGTGGTATTGATCATACTTTAT
TATCATATGCATGTTATATTT
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Peach_Consensus_map_20181N/A8.99SNP_IGA_10635-8.99View
2Peach-ZC-F2-20181N/A7.15SNP_IGA_10635-7.15View
3peach-ZC-F21_1N/A6.12SNP_IGA_10635View
4Peach-DvsS-BC2LG1N/A7SNP_IGA_10635View
5Peach-Bigtop-F1G1N/A4.4SNP_IGA_10635View
6Peach-WB-F2-2015LG1N/A9.11SNP_IGA_10635View
7Peach-PF-Recurrent-2017LG1N/A4.2SNP_IGA_10635View
8Prunus-TE-F2-20151N/A3.2SA10635View
9Prunus-TE-BC1-T1EG1_T1EN/A4.1SA10635View
Alignments
Feature NameTypeLocationAnalysis
scaffold_1 supercontig scaffold_1:3516065..3516065. Prunus persica Whole Genome v1.0 Assembly & Annotation
Pp01 chromosome Pp01:3515828..3515828. Prunus persica Whole Genome Assembly v2.0 & Annotation v2.1 (v2.0.a1)