SNP_IGA_2056, SNP_IGA_2056 (genetic_marker) Prunus persica

Marker Overview
NameSNP_IGA_2056
AliasSA2056
dbSNP IDN/A
SNP Array ID
IRSC 16K SNP array for peach:SNP_IGA_2056
IRSC 9K SNP array for peach:SNP_IGA_2056
TypeSNP
SNP Alleles[T/G]
SpeciesPrunus persica
Primer 1SNP_IGA_2056_LEFT_primer_0: TGAGAATCTCTAGTGGTTGCGA
Primer 2SNP_IGA_2056_RIGHT_primer_0: AGCACCTTTACCAAAGAACCAA
Product Length250
Publication[view all]
ContactPere Arus
Ksenija Gasic
Contact
NameDetails
Pere Arus
First name:Pere
Last name:Arus
Title:Researcher
Institution:IRTA
Address:IRTA, Centre de Recerca en Agrigeno`mica CSIC-IRTA-UAB-UB; Campus UAB, Bellaterra (Cerdanyola del Valle`s), 08193 Barcelona, Spain
Country:Spain
Email:pere.arus@irta.cat
Ksenija Gasic
Description:fruit quality, abiotic and biotic tolerance /resistance
First name:Ksenija
Last name:Gasic
Title:Assistant professor
Institution:Clemson University
Address:112 BRC/ 51 New Cherry Rd, Clemson Sc 29634
Country:USA
Email:kgasic@clemson.edu
Phone:864.656.3664.
Fax:864-656-4960
Keywords:Traditional and molecular plant breeding
Analyses
This genetic_marker is derived from or has results from the following analyses
Analysis NameDate Performed
RosBREED SNP development2011-01-01
Alignment of IRSC SNP array 9K to Peach Genome v2.0.a12016-11-21
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
SNP_IGA_2056_LEFT_primer_0SNP_IGA_2056_LEFT_primer_0Prunus persicaprimer
SNP_IGA_2056_RIGHT_primer_0SNP_IGA_2056_RIGHT_primer_0Prunus persicaprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
SNP_IGA_2056SNP_IGA_2056-1.1Prunus persicamarker_locus
SNP_IGA_2056SNP_IGA_2056Prunus persicamarker_locus
SNP_IGA_2056SNP_IGA_2056Prunus spp.marker_locus
SA2056SA2056Prunus spp.marker_locus


Sequence
>SNP_IGA_2056 ID=SNP_IGA_2056|Name=SNP_IGA_2056|organism=Prunus persica|type=genetic_marker|length=121bp
CAAGCACCTTTCCGACAAGGCTTCCACCGTGGTAATGCCAGTATGTGGCG
AAATTATCTCKACAAAATCTTTGGAAGGCTTTATCATCATTTTGGTTCTT
TGGTAAAGGTGCTCCCAAATA
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Peach_Consensus_map_20181N/A1.1SNP_IGA_2056-1.1View
2Peach-ZC-F2-20181N/A0SNP_IGA_2056View
3peach-ZC-F21_1N/A0SNP_IGA_2056View
4Peach-VV-F2G1N/A1.1SNP_IGA_2056View
5Peach-PF-BC1-2017LG1N/A0SNP_IGA_2056View
6Peach-PF-F1-2017LG1N/A0SNP_IGA_2056View
7Prunus-TE-F2-20151N/A0SA2056View
8Prunus-TE-BC1-EG1_EN/A0SA2056View
Alignments
Feature NameTypeLocationAnalysis
scaffold_1 supercontig scaffold_1:639558..639558. Prunus persica Whole Genome v1.0 Assembly & Annotation
Pp01 chromosome Pp01:639476..639476. Prunus persica Whole Genome Assembly v2.0 & Annotation v2.1 (v2.0.a1)