SNP_IGA_3931, SNP_IGA_3931 (genetic_marker) Prunus persica

Marker Overview
NameSNP_IGA_3931
dbSNP IDN/A
SNP Array ID
IRSC 16K SNP array for peach:SNP_IGA_3931
IRSC 9K SNP array for peach:SNP_IGA_3931
TypeSNP
SNP Alleles[A/G]
SpeciesPrunus persica
Primer 1SNP_IGA_3931_LEFT_primer_0: ACGACCTAGTCCAACAAATGCT
Primer 2SNP_IGA_3931_RIGHT_primer_0: ATTGAAGCTAAAGGGCAACAAG
Product Length288
ContactKsenija Gasic
Contact
NameDetails
Ksenija Gasic
Description:fruit quality, abiotic and biotic tolerance /resistance
First name:Ksenija
Last name:Gasic
Title:Assistant professor
Institution:Clemson University
Address:112 BRC/ 51 New Cherry Rd, Clemson Sc 29634
Country:USA
Email:kgasic@clemson.edu
Phone:864.656.3664.
Fax:864-656-4960
Keywords:Traditional and molecular plant breeding
Analyses
This genetic_marker is derived from or has results from the following analyses
Analysis NameDate Performed
RosBREED SNP development2011-01-01
Alignment of IRSC SNP array 9K to Peach Genome v2.0.a12016-11-21
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
SNP_IGA_3931_LEFT_primer_0SNP_IGA_3931_LEFT_primer_0Prunus persicaprimer
SNP_IGA_3931_RIGHT_primer_0SNP_IGA_3931_RIGHT_primer_0Prunus persicaprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
SNP_IGA_3931SNP_IGA_3931-2.8Prunus persicamarker_locus
SNP_IGA_3931SNP_IGA_3931Prunus persicamarker_locus
SA3931SA3931Prunus persicamarker_locus


Sequence
>SNP_IGA_3931 ID=SNP_IGA_3931|Name=SNP_IGA_3931|organism=Prunus persica|type=genetic_marker|length=121bp
CTTAGGGTGAAAGATGAATCTAGAAGAAATCTTCAACGACCTAGTCCAAC
AAATGCTCTCRCCGGGCACTGCACTTCATCTAAAATCAAGATTCTTAAAG
ATTATGATTATATGTTTTTGT
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Peach_Consensus_map_20181N/A2.8SNP_IGA_3931-2.8View
2Peach-OC-F21N/A3.9SNP_IGA_3931View
3Peach-VV-F2G1N/A2.9SNP_IGA_3931View
4Prunus-TE-F2-20151N/A1.2SA3931View
Alignments
Feature NameTypeLocationAnalysis
scaffold_1 supercontig scaffold_1:1335387..1335387. Prunus persica Whole Genome v1.0 Assembly & Annotation
Pp01 chromosome Pp01:1335246..1335246. Prunus persica Whole Genome Assembly v2.0 & Annotation v2.1 (v2.0.a1)