rs159238089, rs159238089 (genetic_marker) Prunus persica

Marker Overview
Namers159238089
AliasSNP_at_scaffold_7:12614316-0_B_R_1828798506
dbSNP IDss275382932
TypeSNP
SNP AllelesT/C
SpeciesPrunus persica
Publication[view all]
ContactPedro Martinez-Garcia
CommentBOT
Contact
NameDetails
Pedro Martinez-Garcia
First name:Pedro
Last name:Martinez-Garcia
Title:Researcher
Institution:University of California
Address:Department of Plant Sciences, University of California, One Shields Ave, Davis, CA 95616, USA
Country:China
Email:pjmartinezgarcia@ucdavis.edu
Analyses
This genetic_marker is derived from or has results from the following analyses
Analysis NameDate Performed
UC Davis 6K Prunus persica SNPs 2011-11-22
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
rs159238089rs159238089Prunus persicamarker_locus


Sequence
>rs159238089 ID=rs159238089|Name=rs159238089|organism=Prunus persica|type=genetic_marker|length=125bp
GCCATCCTCAGAACCCAAACAATCCCAAAAGTTACTGAAACATTGAACAA
TACTTGCACA[A/G]ACAGAGAGTGCAACAAAAAGAAAAGTGGGCAATTT
GAAAAAGAAAGAACAAGAAAAAACA
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Peach_DGxDF_Consensus-2013LG7N/A20.72rs159238089View
2Peach-DF-F1-2013LG7N/A13.34rs159238089View
3Peach-DG-F1-2013LG7N/A37.98rs159238089View
Alignments
Feature NameTypeLocationAnalysis
scaffold_7 supercontig scaffold_7:12614316..12614316. Prunus persica Whole Genome v1.0 Assembly & Annotation