RosBREEDSNP_SNP_AG_17236158_Lg1_RosCOS3372_MAF30_45786_exon1, RosBREEDSNP_SNP_AG_17236158_Lg1_RosCOS3372_MAF30_45786_exon1 (genetic_marker) Malus x domestica

Marker Overview
NameRosBREEDSNP_SNP_AG_17236158_Lg1_RosCOS3372_MAF30_45786_exon1
Aliasss475876773
rs267609720
R_17236158_L1_PA
dbSNP IDss475876773
SNP Array ID
480K SNP array for apple:AX-115183372
IRSC 9K SNP array for apple:RosBREEDSNP_SNP_AG_17236158_Lg1_RosCOS3372_MAF30_45786_exon1
20K SNP array for apple:RosBREEDSNP_SNP_AG_17236158_Lg1_RosCOS3372_MAF30_45786_exon1
TypeSNP
SNP AllelesT/C
Probe 1RosBREEDSNP_SNP_AG_17236158_Lg1_RosCOS3372_MAF30_45786_exon1.probe: ATATCAAACGATTTAGTGGGACAGAATTGTCTTCCCATTTGTTTTGCGGG
5' Flanking SequenceAAAAAGAGAGAGAAACTAAAAGATTAAGGGAAGAAAAAAGAAATCGAGGACTTTAAAGCA C
3' Flanking SequenceCCCGCAAAACAAATGGGAAGACAATTCTGTCCCACTAAATCGTTTGATATGCAAAAAGTG A
SpeciesMalus x domestica
Publication[view all]
ContactMichela Troggio
Contact
NameDetails
Michela Troggio
First name:Michela
Last name:Troggio
Title:Researcher
Institution:Research and Innovation Centre, Fondazione Edmund Mach
Address:Via Edmund Mach, 1, 38010 San Michele All'adige TN, Italy
Country:Italy
Email:ti.hcamf@oiggort.alehcim
Phone:+39 0461 615111
Fax:+39 0461 650218
Analyses
This genetic_marker is derived from or has results from the following analyses
Analysis NameDate Performed
RosBREED SNP development2011-01-01
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
RosBREEDSNP_SNP_AG_17236158_Lg1_RosCOS3372_MAF30_45786_exon1RosBREEDSNP_SNP_AG_17236158_Lg1_RosCOS3372_MAF30_45786_exon1-38.94Malus x domesticamarker_locus
RosBREEDSNP_SNP_AG_17236158_Lg1_RosCOS3372_MAF30_45786_exon1RosBREEDSNP_SNP_AG_17236158_Lg1_RosCOS3372_MAF30_45786_exon1-20.656Malus x domesticamarker_locus
RosBREEDSNP_SNP_AG_17236158_Lg1_RosCOS3372_MAF30_45786_exon1RosBREEDSNP_SNP_AG_17236158_Lg1_RosCOS3372_MAF30_45786_exon1Malus x domesticamarker_locus


The following probe feature(s) are associated with this genetic_marker:

Feature NameUnique NameSpeciesType
probeRosBREEDSNP_SNP_AG_17236158_Lg1_RosCOS3372_MAF30_45786_exon1.probeMalus x domesticaprobe


Sequence
>RosBREEDSNP_SNP_AG_17236158_Lg1_RosCOS3372_MAF30_45786_exon1 ID=RosBREEDSNP_SNP_AG_17236158_Lg1_RosCOS3372_MAF30_45786_exon1|Name=RosBREEDSNP_SNP_AG_17236158_Lg1_RosCOS3372_MAF30_45786_exon1|organism=Malus x domestica|type=genetic_marker|length=75bp
AGGGAAGAAAAAAGAAATCGAGGACTTTAAAGCAC[A/G]CCCGCAAAAC
AAATGGGAAGACAATTCTGTCCCAC
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Pear-PH-CG-2017LG1N/A38.94RosBREEDSNP_SNP_AG_17236158_Lg1_RosCOS3372_MAF30_45786_exon1-38.94View
2Apple-Honeycrisp_Consensus-F11N/A20.66RosBREEDSNP_SNP_AG_17236158_Lg1_RosCOS3372_MAF30_45786_exon1-20.656View
3Apple-M432-20131N/A26.51RosBREEDSNP_SNP_AG_17236158_Lg1_RosCOS3372_MAF30_45786_exon1View
4Apple-M432-2013-physical-Malus-domestica1N/A17236158RosBREEDSNP_SNP_AG_17236158_Lg1_RosCOS3372_MAF30_45786_exon1View
Alignments
Feature NameTypeLocationAnalysis
MDC009632.125 contig MDC009632.125:24937..24937. Malus x domestica Whole Genome v1.0 Assembly & Annotation
Chr01 chromosome Chr01:21502953..21502953- Malus x domestica GDDH13 v1.1 Whole Genome Assembly & Annotation