RosBREEDSNP_SNP_TG_8522809_Lg10_00260_MAF40_483111_exon1, RosBREEDSNP_SNP_TG_8522809_Lg10_00260_MAF40_483111_exon1 (genetic_marker) Malus x domestica

Marker Overview
NameRosBREEDSNP_SNP_TG_8522809_Lg10_00260_MAF40_483111_exon1
Aliasss475879655
rs267612601
R_8522809_L10_33_1
dbSNP IDss475879655
SNP Array ID
480K SNP array for apple:AX-105207035
IRSC 9K SNP array for apple:RosBREEDSNP_SNP_TG_8522809_Lg10_00260_MAF40_483111_exon1
20K SNP array for apple:RosBREEDSNP_SNP_TG_8522809_Lg10_00260_MAF40_483111_exon1
TypeSNP
SNP AllelesA/C
Probe 1RosBREEDSNP_SNP_TG_8522809_Lg10_00260_MAF40_483111_exon1.probe: TTATGTTGGTTTCAGATATCGGATTGTGGCACTTGAGATCAGAGAAAGAG
5' Flanking SequenceATCCGTTTTTCTTTCCCTGCGAAGAAGACTTACCTCGGATCACCCGGTCAAGTTCTCTCT C
3' Flanking SequenceCTCTTTCTCTGATCTCAAGTGCCACAATCCGATATCTGAAACCAACATAAAAAAAGATGG C
SpeciesMalus x domestica
Publication[view all]
ContactMichela Troggio
Contact
NameDetails
Michela Troggio
First name:Michela
Last name:Troggio
Title:Researcher
Institution:Research and Innovation Centre, Fondazione Edmund Mach
Address:Via Edmund Mach, 1, 38010 San Michele All'adige TN, Italy
Country:Italy
Email:ti.hcamf@oiggort.alehcim
Phone:+39 0461 615111
Fax:+39 0461 650218
Analyses
This genetic_marker is derived from or has results from the following analyses
Analysis NameDate Performed
RosBREED SNP development2011-01-01
Relationships

The following probe feature(s) are associated with this genetic_marker:

Feature NameUnique NameSpeciesType
probeRosBREEDSNP_SNP_TG_8522809_Lg10_00260_MAF40_483111_exon1.probeMalus x domesticaprobe


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
RosBREEDSNP_SNP_TG_8522809_Lg10_00260_MAF40_483111_exon1RosBREEDSNP_SNP_TG_8522809_Lg10_00260_MAF40_483111_exon1Malus x domesticamarker_locus


Sequence
>RosBREEDSNP_SNP_TG_8522809_Lg10_00260_MAF40_483111_exon1 ID=RosBREEDSNP_SNP_TG_8522809_Lg10_00260_MAF40_483111_exon1|Name=RosBREEDSNP_SNP_TG_8522809_Lg10_00260_MAF40_483111_exon1|organism=Malus x domestica|type=genetic_marker|length=75bp
GACTTACCTCGGATCACCCGGTCAAGTTCTCTCTC[G/T]CTCTTTCTCT
GATCTCAAGTGCCACAATCCGATAT
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Apple-M432-20138N/A24.79RosBREEDSNP_SNP_TG_8522809_Lg10_00260_MAF40_483111_exon1View
2Apple-M432-2013-physical-Malus-domestica10N/A8522809RosBREEDSNP_SNP_TG_8522809_Lg10_00260_MAF40_483111_exon1View
Alignments
Feature NameTypeLocationAnalysis
MDC009912.411 contig MDC009912.411:2792..2792. Malus x domestica Whole Genome v1.0 Assembly & Annotation
Chr10 chromosome Chr10:20663267..20663267+ Malus x domestica GDDH13 v1.1 Whole Genome Assembly & Annotation