GDsnp00522, GDsnp00522 (genetic_marker) Malus x domestica

Marker Overview
NameGDsnp00522
Aliasss475882476
rs267615421
b475882476
GD_SNP00522
GD_SNP00522_F
dbSNP IDss475882476
SNP Array ID
IRSC 9K SNP array for apple:GDsnp00522
TypeSNP
SNP AllelesA/G
5' Flanking SequenceCCTCAAAGCACTTCTACTGGTCTGT
3' Flanking SequenceTATATCCCCCTTCATACTTACTCTC
SpeciesMalus x domestica
Publication[view all]
ContactCindy F. Verdu
Contact
NameDetails
Cindy F. Verdu
First name:Cindy
Last name:Verdu
Title:Researcher
Institution:INRA
Address:INRA, UMR1345 Institut de Recherche en Horticulture et Semences, Beaucouze, France
Country:France
Email:cindyverdu@gmail.com
Analyses
This genetic_marker is derived from or has results from the following analyses
Analysis NameDate Performed
RosBREED SNP development2011-01-01
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
GDsnp00522GDsnp00522-48.013Malus x domesticamarker_locus
GDsnp00522GDsnp00522Malus x domesticamarker_locus
GD_SNP00522GD_SNP00522Malus x domesticamarker_locus


Publications
YearPublication
2010Velasco R, Zharkikh A, Affourtit J, Dhingra A, Cestaro A, Kalyanaraman A, Fontana P, Bhatnagar SK, Troggio M, Pruss D, Salvi S, Pindo M, Baldi P, Castelletti S, Cavaiuolo M, Coppola G, Costa F, Cova V, Dal Ri A, Goremykin V, Komjanc M, Longhi S, Magnago P, Malacarne G, Malnoy M, Micheletti D, Moretto M, Perazzolli M, Si-Ammour A, Vezzulli S, Zini E, Eldredge G, Fitzgerald LM, Gutin N, Lanchbury J, Macalma T, Mitchell JT, Reid J, Wardell B, Kodira C, Chen Z, Desany B, Niazi F, Palmer M, Koepke T, Jiwan D, Schaeffer S, Krishnan V, Wu C, Chu VT, King ST, Vick J, Tao Q, Mraz A, Stormo A, Stormo K, Bogden R, Ederle D, Stella A, Vecchietti A, Kater MM, Masiero S, Lasserre P, Lespinasse Y, Allan AC, Bus V, Chagné D, Crowhurst RN, Gleave AP, Lavezzo E, Fawcett JA, Proost S, Rouzé P, Sterck L, Toppo S, Lazzari B, Hellens RP, Durel CE, Gutin A, Bumgarner RE, Gardiner SE, Skolnick M, Egholm M, Van de Peer Y, Salamini F, Viola R. The genome of the domesticated apple (Malus x domestica Borkh.). Nature Genetics. 2010 Oct; 42(10):833-839.
2012Chagné D, Crowhurst RN, Troggio M, Davey MW, Gilmore B, Lawley C, Vanderzande S, Hellens RP, Kumar S, Cestaro A, Velasco R, Main D, Rees JD, Iezzoni A, Mockler T, Wilhelm L, Van de Weg E, Gardiner SE, Bassil N, Peace C. Genome-wide SNP detection, validation, and development of an 8K SNP array for apple. PloS one. 2012; 7(2):e31745.
2013Troggio M, Surbanovski N, Bianco L, Moretto M, Giongo L, Banchi E, Viola R, Fernández FF, Costa F, Velasco R, Cestaro A, Sargent DJ. Evaluation of SNP Data from the Malus Infinium Array Identifies Challenges for Genetic Analysis of Complex Genomes of Polyploid Origin. PloS one. 2013; 8(6):e67407.
2014Verdu CF, Guyot S, Childebrand N, Bahut M, Celton J-M, Gaillard S, Lasserre-Zuber P, Troggio M, Guilet D, Laurens F. QTL Analysis and Candidate Gene Mapping for the Polyphenol Content in Cider Apple. PLoS ONE. 2014; 9(10):e107103.
Sequence
>GDsnp00522 ID=GDsnp00522|Name=GDsnp00522|organism=Malus x domestica|type=genetic_marker|length=201bp
TCGCAAGAAGGATTTCGTGGATATTCTCCTCCAAGTTCAAAAGGATGGCA
ATGACTTTGAGCTCAAAAGTGACCACCTCAAAGCACTTCTACTGGTCTGT
RTATATCCCCCTTCATACTTACTCTCTTTAACAATAACATTATATATATG
GCTGAAGATTGATTTGGCTTCTTAAGTTACGATTTCAGGACATGTTTGTC
G
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Apple-Honeycrisp_Consensus-F114N/A48.01GDsnp00522-48.013View
2Apple-FjxPL-F1-2013LG14N/A57.73GDsnp00522View
3Apple Integrated map14N/A46.9GDsnp00522View
4Apple-M432-201314N/A36.07GDsnp00522View
5Apple-M432-2013-physical-Malus-domestica14N/A22011006GDsnp00522View
6Apple-X3259X3263-F114N/A54.74GD_SNP00522View
Alignments
Feature NameTypeLocationAnalysis
MDC013874.464 contig MDC013874.464:1290..1290. Malus x domestica Whole Genome v1.0 Assembly & Annotation