MDC010648.242, MDC010648.242 (contig) Malus x domestica

Contig Overview
NameMDC010648.242
Unique NameMDC010648.242
Typecontig
OrganismMalus x domestica (Apple)
Sequence length26832
Analyses
This contig is derived from or has results from the following analyses
Analysis NameDate Performed
Malus x domestica Whole Genome v1.0 Assembly & Annotation2012-07-26
Alignments
Feature NameTypeLocationAnalysis
MDP0000188069 mRNA MDP0000188069:5308..7329+ Malus x domestica Whole Genome v1.0 Assembly & Annotation
MDP0000188069_exon_1 CDS MDP0000188069_exon_1:5308..5750+ Malus x domestica Whole Genome v1.0 Assembly & Annotation
MDP0000188069_exon_2 CDS MDP0000188069_exon_2:5977..6079+ Malus x domestica Whole Genome v1.0 Assembly & Annotation
MDP0000188069_exon_3 CDS MDP0000188069_exon_3:6307..7329+ Malus x domestica Whole Genome v1.0 Assembly & Annotation
MDP0000188072 mRNA MDP0000188072:21675..24113- Malus x domestica Whole Genome v1.0 Assembly & Annotation
MDP0000188072_exon_1 CDS MDP0000188072_exon_1:23988..24113- Malus x domestica Whole Genome v1.0 Assembly & Annotation
MDP0000188072_exon_2 CDS MDP0000188072_exon_2:23258..23575- Malus x domestica Whole Genome v1.0 Assembly & Annotation
MDP0000188072_exon_3 CDS MDP0000188072_exon_3:22937..22997- Malus x domestica Whole Genome v1.0 Assembly & Annotation
MDP0000188072_exon_4 CDS MDP0000188072_exon_4:21675..22675- Malus x domestica Whole Genome v1.0 Assembly & Annotation
MDP0000188073 mRNA MDP0000188073:25189..25771+ Malus x domestica Whole Genome v1.0 Assembly & Annotation
MDP0000188073_exon_1 CDS MDP0000188073_exon_1:25189..25413+ Malus x domestica Whole Genome v1.0 Assembly & Annotation
MDP0000188073_exon_2 CDS MDP0000188073_exon_2:25490..25615+ Malus x domestica Whole Genome v1.0 Assembly & Annotation
MDP0000188073_exon_3 CDS MDP0000188073_exon_3:25745..25771+ Malus x domestica Whole Genome v1.0 Assembly & Annotation
MDP0000287448 mRNA MDP0000287448:2553..3622- Malus x domestica Whole Genome v1.0 Assembly & Annotation
MDP0000287448_exon_1 CDS MDP0000287448_exon_1:3486..3622- Malus x domestica Whole Genome v1.0 Assembly & Annotation
MDP0000287448_exon_2 CDS MDP0000287448_exon_2:3244..3365- Malus x domestica Whole Genome v1.0 Assembly & Annotation
MDP0000287448_exon_3 CDS MDP0000287448_exon_3:2879..3075- Malus x domestica Whole Genome v1.0 Assembly & Annotation
MDP0000287448_exon_4 CDS MDP0000287448_exon_4:2553..2795- Malus x domestica Whole Genome v1.0 Assembly & Annotation
MDP0000287451 mRNA MDP0000287451:12830..20392- Malus x domestica Whole Genome v1.0 Assembly & Annotation
MDP0000287451_exon_1 CDS MDP0000287451_exon_1:20015..20392- Malus x domestica Whole Genome v1.0 Assembly & Annotation
MDP0000287451_exon_2 CDS MDP0000287451_exon_2:19656..19938- Malus x domestica Whole Genome v1.0 Assembly & Annotation
MDP0000287451_exon_3 CDS MDP0000287451_exon_3:19514..19581- Malus x domestica Whole Genome v1.0 Assembly & Annotation
MDP0000287451_exon_4 CDS MDP0000287451_exon_4:19371..19472- Malus x domestica Whole Genome v1.0 Assembly & Annotation
MDP0000287451_exon_5 CDS MDP0000287451_exon_5:19102..19170- Malus x domestica Whole Genome v1.0 Assembly & Annotation
MDP0000287451_exon_6 CDS MDP0000287451_exon_6:18948..19007- Malus x domestica Whole Genome v1.0 Assembly & Annotation
MDP0000287451_exon_7 CDS MDP0000287451_exon_7:18688..18801- Malus x domestica Whole Genome v1.0 Assembly & Annotation
MDP0000287451_exon_8 CDS MDP0000287451_exon_8:18300..18348- Malus x domestica Whole Genome v1.0 Assembly & Annotation
MDP0000287451_exon_9 CDS MDP0000287451_exon_9:17434..17543- Malus x domestica Whole Genome v1.0 Assembly & Annotation
MDP0000287451_exon_10 CDS MDP0000287451_exon_10:17111..17203- Malus x domestica Whole Genome v1.0 Assembly & Annotation
MDP0000287451_exon_11 CDS MDP0000287451_exon_11:16905..16997- Malus x domestica Whole Genome v1.0 Assembly & Annotation
MDP0000287451_exon_12 CDS MDP0000287451_exon_12:16664..16801- Malus x domestica Whole Genome v1.0 Assembly & Annotation
MDP0000287451_exon_13 CDS MDP0000287451_exon_13:15399..15485- Malus x domestica Whole Genome v1.0 Assembly & Annotation
MDP0000287451_exon_14 CDS MDP0000287451_exon_14:14735..14812- Malus x domestica Whole Genome v1.0 Assembly & Annotation
MDP0000287451_exon_15 CDS MDP0000287451_exon_15:14010..14094- Malus x domestica Whole Genome v1.0 Assembly & Annotation
MDP0000287451_exon_16 CDS MDP0000287451_exon_16:13780..13904- Malus x domestica Whole Genome v1.0 Assembly & Annotation
MDP0000287451_exon_17 CDS MDP0000287451_exon_17:13522..13665- Malus x domestica Whole Genome v1.0 Assembly & Annotation
MDP0000287451_exon_18 CDS MDP0000287451_exon_18:13375..13427- Malus x domestica Whole Genome v1.0 Assembly & Annotation
MDP0000287451_exon_19 CDS MDP0000287451_exon_19:13112..13211- Malus x domestica Whole Genome v1.0 Assembly & Annotation
MDP0000287451_exon_20 CDS MDP0000287451_exon_20:12830..13006- Malus x domestica Whole Genome v1.0 Assembly & Annotation
MDP0000742177 mRNA MDP0000742177:9559..12434+ Malus x domestica Whole Genome v1.0 Assembly & Annotation
MDP0000742177_exon_1 CDS MDP0000742177_exon_1:9559..10007+ Malus x domestica Whole Genome v1.0 Assembly & Annotation
MDP0000742177_exon_2 CDS MDP0000742177_exon_2:11045..11147+ Malus x domestica Whole Genome v1.0 Assembly & Annotation
MDP0000742177_exon_3 CDS MDP0000742177_exon_3:11313..12434+ Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_GA_5168149_Lg8_01378_MAF10_471048_exon1 genetic_marker RosBREEDSNP_SNP_GA_5168149_Lg8_01378_MAF10_471048_exon1:14071..14071. Malus x domestica Whole Genome v1.0 Assembly & Annotation
Pear_Bartlett_SNP_CT_393_5147070 genetic_marker Pear_Bartlett_SNP_CT_393_5147070:12191..12191. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_GA_5173996_Lg8_01378_MAF40_526644_exon2 genetic_marker RosBREEDSNP_SNP_GA_5173996_Lg8_01378_MAF40_526644_exon2:19918..19918. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_GA_5157399_Lg8_01378_MAF30_MDP0000188682_exon2 genetic_marker RosBREEDSNP_SNP_GA_5157399_Lg8_01378_MAF30_MDP0000188682_exon2:3321..3321. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_GA_5159668_Lg8_01378_MAF10_MDP0000150374_exon1 genetic_marker RosBREEDSNP_SNP_GA_5159668_Lg8_01378_MAF10_MDP0000150374_exon1:5590..5590. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_CT_5166014_Lg8_01378_MAF30_1645550_exon1 genetic_marker RosBREEDSNP_SNP_CT_5166014_Lg8_01378_MAF30_1645550_exon1:11936..11936. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_AG_5155962_Lg8 genetic_marker RosBREEDSNP_SNP_AG_5155962_Lg8:1884..1884. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_TC_5155999_Lg8 genetic_marker RosBREEDSNP_SNP_TC_5155999_Lg8:1921..1921. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_TC_5156027_Lg8 genetic_marker RosBREEDSNP_SNP_TC_5156027_Lg8:1949..1949. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_CA_5156068_Lg8 genetic_marker RosBREEDSNP_SNP_CA_5156068_Lg8:1990..1990. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_TC_5156138_Lg8 genetic_marker RosBREEDSNP_SNP_TC_5156138_Lg8:2060..2060. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_GA_5156139_Lg8 genetic_marker RosBREEDSNP_SNP_GA_5156139_Lg8:2061..2061. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_CT_5156665_Lg8 genetic_marker RosBREEDSNP_SNP_CT_5156665_Lg8:2587..2587. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_CA_5156693_Lg8 genetic_marker RosBREEDSNP_SNP_CA_5156693_Lg8:2615..2615. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_GA_5156774_Lg8 genetic_marker RosBREEDSNP_SNP_GA_5156774_Lg8:2696..2696. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_CT_5156860_Lg8 genetic_marker RosBREEDSNP_SNP_CT_5156860_Lg8:2782..2782. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_GA_5156891_Lg8 genetic_marker RosBREEDSNP_SNP_GA_5156891_Lg8:2813..2813. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_CA_5156915_Lg8 genetic_marker RosBREEDSNP_SNP_CA_5156915_Lg8:2837..2837. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_TC_5156928_Lg8 genetic_marker RosBREEDSNP_SNP_TC_5156928_Lg8:2850..2850. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_TG_5156970_Lg8 genetic_marker RosBREEDSNP_SNP_TG_5156970_Lg8:2892..2892. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_CT_5156972_Lg8 genetic_marker RosBREEDSNP_SNP_CT_5156972_Lg8:2894..2894. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_TC_5156990_Lg8 genetic_marker RosBREEDSNP_SNP_TC_5156990_Lg8:2912..2912. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_AG_5157041_Lg8 genetic_marker RosBREEDSNP_SNP_AG_5157041_Lg8:2963..2963. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_TC_5157052_Lg8 genetic_marker RosBREEDSNP_SNP_TC_5157052_Lg8:2974..2974. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_CA_5157068_Lg8 genetic_marker RosBREEDSNP_SNP_CA_5157068_Lg8:2990..2990. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_GA_5157080_Lg8 genetic_marker RosBREEDSNP_SNP_GA_5157080_Lg8:3002..3002. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_TC_5157300_Lg8 genetic_marker RosBREEDSNP_SNP_TC_5157300_Lg8:3222..3222. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_GA_5157399_Lg8 genetic_marker RosBREEDSNP_SNP_GA_5157399_Lg8:3321..3321. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_TC_5157491_Lg8 genetic_marker RosBREEDSNP_SNP_TC_5157491_Lg8:3413..3413. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_GA_5157612_Lg8 genetic_marker RosBREEDSNP_SNP_GA_5157612_Lg8:3534..3534. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_TC_5157824_Lg8 genetic_marker RosBREEDSNP_SNP_TC_5157824_Lg8:3746..3746. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_GA_5157854_Lg8 genetic_marker RosBREEDSNP_SNP_GA_5157854_Lg8:3776..3776. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_AG_5158024_Lg8 genetic_marker RosBREEDSNP_SNP_AG_5158024_Lg8:3946..3946. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_CT_5158037_Lg8 genetic_marker RosBREEDSNP_SNP_CT_5158037_Lg8:3959..3959. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_CT_5158207_Lg8 genetic_marker RosBREEDSNP_SNP_CT_5158207_Lg8:4129..4129. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_CT_5158231_Lg8 genetic_marker RosBREEDSNP_SNP_CT_5158231_Lg8:4153..4153. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_GA_5158784_Lg8 genetic_marker RosBREEDSNP_SNP_GA_5158784_Lg8:4706..4706. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_CT_5158833_Lg8 genetic_marker RosBREEDSNP_SNP_CT_5158833_Lg8:4755..4755. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_GA_5159668_Lg8 genetic_marker RosBREEDSNP_SNP_GA_5159668_Lg8:5590..5590. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_CT_5159793_Lg8 genetic_marker RosBREEDSNP_SNP_CT_5159793_Lg8:5715..5715. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_AG_5159835_Lg8 genetic_marker RosBREEDSNP_SNP_AG_5159835_Lg8:5757..5757. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_AG_5159856_Lg8 genetic_marker RosBREEDSNP_SNP_AG_5159856_Lg8:5778..5778. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_TC_5159868_Lg8 genetic_marker RosBREEDSNP_SNP_TC_5159868_Lg8:5790..5790. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_CT_5164074_Lg8 genetic_marker RosBREEDSNP_SNP_CT_5164074_Lg8:9996..9996. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_TC_5164231_Lg8 genetic_marker RosBREEDSNP_SNP_TC_5164231_Lg8:10153..10153. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_AG_5164921_Lg8 genetic_marker RosBREEDSNP_SNP_AG_5164921_Lg8:10843..10843. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_GA_5164974_Lg8 genetic_marker RosBREEDSNP_SNP_GA_5164974_Lg8:10896..10896. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_CT_5166014_Lg8 genetic_marker RosBREEDSNP_SNP_CT_5166014_Lg8:11936..11936. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_GT_5166203_Lg8 genetic_marker RosBREEDSNP_SNP_GT_5166203_Lg8:12125..12125. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_CT_5166248_Lg8 genetic_marker RosBREEDSNP_SNP_CT_5166248_Lg8:12170..12170. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_CA_5167022_Lg8 genetic_marker RosBREEDSNP_SNP_CA_5167022_Lg8:12944..12944. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_GA_5167087_Lg8 genetic_marker RosBREEDSNP_SNP_GA_5167087_Lg8:13009..13009. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_CT_5167112_Lg8 genetic_marker RosBREEDSNP_SNP_CT_5167112_Lg8:13034..13034. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_CA_5167138_Lg8 genetic_marker RosBREEDSNP_SNP_CA_5167138_Lg8:13060..13060. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_TC_5167523_Lg8 genetic_marker RosBREEDSNP_SNP_TC_5167523_Lg8:13445..13445. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_GT_5167574_Lg8 genetic_marker RosBREEDSNP_SNP_GT_5167574_Lg8:13496..13496. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_GA_5167648_Lg8 genetic_marker RosBREEDSNP_SNP_GA_5167648_Lg8:13570..13570. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_GA_5167756_Lg8 genetic_marker RosBREEDSNP_SNP_GA_5167756_Lg8:13678..13678. Malus x domestica Whole Genome v1.0 Assembly & Annotation
chr8 chromosome chr8:4580708..4607539+ Malus x domestica Whole Genome v1.0 Assembly & Annotation
Sequences
The following sequences are available for this feature:

contig sequence

>MDC010648.242 ID=MDC010648.242|Name=MDC010648.242|organism=Malus x domestica|type=contig|length=26832bp
TATAGGTATATATATATAGAAAGCAATGCCCACTCACTGGTATGTCGCCG
GGTCGTAACCCCCTTGACGCCCCTGGATGTGCTCGTCCTCGTTATAAGTT
CCACCTAGAAGTGAAATAACTTAAAACAATCATTTAACGCACAATTAACG
CACCTAAACCAAACTAGGTAAAAAAATTCTTCATACGATGCTCAAATTGG
GTATATGAATATACCACAGTGACCTACACAACCTCAGGATCATCCCCAAA
TTTTTAAAATAATTTTTGGAGTCCTCACGCGCCCCCACGCGCCTGACGTG
GCACGGACCTACGCGCGGCCCACGCGCAGCCACGTGCCAGGCACACTGAC
GGCTACAGTGAACGGCGTTAGGAATATTCCCGGAATATTCCGTTAAAAAC
TAACGGTTTCCGTTAAAGTTAACTAACGGCGTCGGAATATTCCGTCAAAC
TTGACGGAAGATTCCCTGTCTTCTCCGGCGAGTCGCCGGTCGCCGGCGGC
TGTTCGCCGGTTTCTGGAAAATTTTCAAATCCACTATTCTCCTTCGTTTT
TCAACCAATTTCTTCGCATTTTATACCAAAATGAAGCATTTCACATGTAC
TATCACGTTGGAAGGGTTTTAAGGCCTAAAAACAACAAGATCAAACCTTT
CAAAATTCTTCAATTTCGGCCAAACTCGAACCCGACGATCCCGACGTCCA
TTTTGTTCAAACGAGGCACTCCGAGCCTCCTTGGAACTTCCTAAGACTCG
TGGTGATCTTTGTTTAACCTAAAACACAACCAAAATTAAGTTCGTGAACA
GTGCCATTACACGGGGTGTTTTAAAACTAGGGTTCTCGAAATAGAACTTA
CCTAAAACTGGTATTCCCGTGCTCGTGAGGTCCTAAGGAGTGTCGTGGTG
ATCTTAGATCGGACGTTGGTGTAGGATTGTGATTGTTCTTGGTGTTTGTC
CGAGAGCTTGAGAGAGTTCGAGAGTAAGAGAGAGAGAGTGATACTGAAAT
GAAGAAAGAGAGAGAGAGAGTGAAGGGAGATGAGAGAGAGACATCCCACG
GGTTTTGGGGAGGGATTTAGGGGGTAGGACCCCACCCTAAGTCCAAACAC
AAATTAAATTAACACATACTAATATAATTCTAACCCTAGTTTAGGATCTT
AGTGTAAAACAAATACCAAATTTACGCACCTTAATCCCGTTTAAGGGCGT
TTTAGTAATTTCACGTCCTCGGTATTTAGTAACTCTGGGACGGGCTGTGA
CAGATAATATCCCGATATTTCCATCGAAATTTCTATGTTTTTTTACAACC
AATATTTCCAATATCATCGATATTTTATACCTTGCTCCTGACCCATTGAC
GACCACCATGTTTGTCAAGATCAAGGTATAAAATATCGATGATATCGGAA
ATATCGGTAGTCCAAAAACACGGAAATTTCGATGGAAATATCGGGATATT
ATCGATATCGATAAAAATTGAATAAAAACCACGAAAATTGTAAGAAAAAC
TTGGAAATTTTTATTGAAACTTTGCAGGATGTTTATTTAGTCAATTATCT
ATTAGTTTATCACAAAAAATTGGAAGGAAATGCATTGCATGATAGATATA
ACTGATTTAAGTTGATTATATAGCAAGCTGACAAACATTGTGAGTGTAGA
AAATATGTAGTAATTAATGAAAGAAGTTTAAACACACCATAATCATTTAT
ATATAATGAATTAGTACAATATTTTACATTTTATACATTGTATGGTAAGA
TACATGAGTGACTTAGCAAGGTCTAAAATATTGATGATATCGGAAATATC
GGTAGTCCAAAAACATATCGGTAGTCCAAAAACACGGAAATATCAATGAA
AATATCGAGATATTATGAATATTTTAGATCATGATCAAGATGTACATTCC
TTCAATATAACACACGCACATTTAGTAGATACTTTACAAGAGAAAAAATA
TTAAAAGGGTAAAGACCACAGAGGGAATATAAAGTTTAACGGTCTAATCA
TTGGCAGCATGCTCAATACATTTCGAAAAATGTACACACCCAAGATTTGC
ACTTCTGGTTGTGAGAGGGAAAATAGAGTTAAATCGCCGAGTTATTTCTA
GCCATTCTTCATCGTATTGAGGGATGGTTGGTTTGGGAGTGAGGTACTTA
AAAAAAAGGCACCCATGAAAAAATCTGTGAGGATTTTAAGTGTTTGGTAA
ACTAAAAAAAAAGAGCTTATTTTGGAAGCTGCTGTGAGAATAAGCTGAAA
TCAAAGAAAAAGATGAAGCTGTTATTTGTAGCTTTAGAAAACTGGTTTTT
TTTTCAAAGCACACGGAGCTACAGTGCTCCTTTAATGAAAATACCCACTA
TCAGACTGCTTTTTTTTTCCAAAAGCATTTTTACAAAAAAGTTTACCAAA
CACTCTACTAATTTATTTCATAGCCGCTTATTCTTACAGCAATTTTTTTT
CAAAGCATAGTAATACCAAACCAGCCCTGAATCTCATAAGGGCCAGGCTC
CGATTCAAATTCAATAACCTAAAATGCCAGAAAATGTCACACGTAGAACC
CATTAGCTACCAGCAATGACTGCGGGGAACATCCTACACAGTACTTTCAG
AATCTCATCAAATACCTGAAGAAATTTGCGTCCTGGTAGGCACTTATCAA
GGGCAAGAAAGTTTGTCACTGAACCATCTTCCCCATGTTGAACACGAGCA
GCAAATTTGCAGTGTAAATGAGCTGAAAACCAATAAGGTGGTTTCAGTTC
TAGCAATTGAGCAGCTGGTTTACTTCCAAGACTTCTTTCTTGAACCTAAT
GACATTTTAAACGAGATAAGTGGTTCGAAAACATACCAATCAGAGCTTAT
TAACTCATTTTTCCGTTCTTGCAATTACCTCCTGCTTAAAATCCGGTTTT
TCCCGAACAAGTTCCTTCCAGTCCCCACAATCAGTGATGCCAACAGGCCA
ATCATGTGAAAGAAAAATATCGATTGGTTCCTCAACTTGCATGAGTTTGT
GGAAATCATACTCACGAACATGATACACCGACCTGATAGTATGACCATTA
CAAGGAGGCCTCTCAAAGTGTCCCGCTCAAGAGGAAAAAAAAATGAACCG
CCTTCAAGCAGTTAACACCATATGTCAAAATAGCACATAGTACATACCAT
AATAGCAAAACATAAACAGCTATTGTTTTACCAACAAAAGATAAGCAATG
AAGTAAACACCTGTAATGGTATACAAAACTAAAGCAAACTAACCTTTAAG
AAAATCGGGCTGCTTGTAAATTCCAGAGAGTCCACCAATTCGAAGATTTC
CAAACTTGACTACACCAGCAGACCCCAAGAAGTATATATTAGGTGCTGCC
CATCCTCCATAGTACCTATACAAACAGCAAAAACAAGTAAAAAACCCCCA
ACAATCATTCATTCAAAGCGAAAAAACCGACACGAAAAACAATTGGAAGG
GAATGCTATAGATTGTAGTTAAAGAAGGGACTCACAGTTCCCATAAGTAA
TTAGAAGCCTCGTGATTGCCGCCGATGAATATGGTCGGGTACGGAGCCAC
TGCCTCACCGGAATAGTATTTCCAGAATGTGTTCATGCTCCGGAATTTAC
GAGGCACGTTTAAGGTCGCCATGCATACAACCTTCTACAGCAATCTTCAT
TCCGATTCCGAAGATGCTGGAATGGGAGTCGGCAACAGGAATGGAGGGAA
ACTCGAACACTACAGTGGCGGTTTAAAGCAGAAGATCGTATTGTTTCGCC
GATTTCTTTTATTTTCGTCTTTCCCGGCTCAAAAAATTCAATTAAAAGTT
GCTCTTAAAATTTTGAAGGTGTATATATTTTGTTTAATAAAGTTCTAATT
AGATTAGGAACATGATCCTGTAATCTTAGGAAATCCATATAGAATTCTAT
CGTATTTTATTTTTTACATAAGTATCATGTTTGTAATACTTATCAAGTAA
GAATTTTACGTTTTCTACTACTATAAATTTCTTGAGATAATACATATCTC
ATAATTAAATCAGACTCTCTTGCATCACCCCTCTATTTCTCCCACTATAT
TCACCTATATTGGTCAGTTAAACATGCCCTACAACATTTAAATATTTATT
AAATTGATAACACGATGAGCATGAAATCCGTAATTATGATTATATATGTA
AGCCACATTTGCACCACATCGATTAAATCCCTTATCAATTTATGGATATT
TAGATGTTCAAATATCTAAAAGGCGTAAATTAATAATATTTCAAAACTTT
AGGAACAATGTGAAAAATATGAAACCTCACCGCACATTTTAAAAGTACCT
CAAGTATCGAAGGTGTAAAATGTATTCATCCCTTAAACATACATAGTGAC
ACAATAATTCATAAAACCCGTTTTAATTGACTTACATTTTTCACATTCGT
AAAAAAGATCTTATAAAATTTCAACAATCTGTCTTTTCACAAAAAACGGT
AAACTTACTCGTGATTTTTACATCGATTTTGCAACGTTTTACATAAAACA
TCGTAATACCAAGCTTCTTTAAAATAAAAAAATTAAAAAAAWTWATTTCT
TGTCATATTTTGCACCTTGATAATATTGGAGGAGGATTCTATACCTTCCT
AATATCTCTACCCTTTCATGCCCTCTTATTTGAACAGTCACGGTTAAACC
ACATCAACATCTTATATTAATTTTTTTATAGAGATAATAAGATAAAAAAC
AATGTGTGAGATGAGAGGATGGAAATGGATGAGAATATAAGGGTAGAGAA
TCCTCCTCCGATAATACTTCTATTAATTTGTAAAAAAATATGTTAAGCTG
TCTTCCGTGCACTGAAAAGTTAAAAACTACTGTTTTGAAGCAAACTAAAA
AGATATCACTCTCAACTCTAATGAAAGATTTTTCTTCCCAGTCTTATGCA
AGTTTAGGTAGGCCTGTATTTCTTGGTTTCAATAGTACTCCTTACGAGCG
TTGTTTTTAAAGTAGTGGTAGGTTCGAGTTTTCTTGTTTTGTCCTTTAGG
TTACAACTTTATATACTCAAACGTTAAATCTCATATTTGAAAACACACTT
TAAAAGAGAAATATTATAATAAAAGCGTAAATTTGAGTTTTAACAACTTA
ATTACGTGCACACTTGTTTGATAAGGATAACAAACAAATGAGGCGCGACA
CATAAATTGATAAAAWGACGGAGAGGTGGGACACATGTGTCGTTTTAAGG
CAACAAGGTTAGGACAATTATTGGACYAACAAAGTTGGAACATGAAACCT
CCRTTAGTCTAAGTTTCCAAAGATTTCAAGCAATCTCTCCTCATCTCCTC
ATCAAAAATGGCTCTCCTTCACCCTYTAGTCTCACACATCTTCCCCTCTT
CCACTCCCAAACCATCAACACCAAAACTAAAATCAAACCCTACACCTCTT
CAACCATCCACATTAGTACTAACAAATAATAAGAGTCGYGATAACATCTC
GGGTGTAGGTAAGTTTCTCTCCARAGCCGTAGTTGCATCTCCGCTTGATC
ATGACGATGATTTGAAGGAAGATGAACAAGAGGATCACAAGGTTTTGGTG
ACTCCTTCCAAAGAAGAAGAGCATGGAGAAGAAAGCGTCGCAACCGGATA
CAATTGGACGGAAGAATGGTACCCTCTTTACCTCACCCAGGACCTGCCTG
ARGATGCACCTTTAGGCCTTACCGTCTTCAATAAGCAGCTCGTCTTGTAT
CGTGATGGCTCGGGCGAGCTTCGCTGTTACGAAGATCGTTGCCCACATAG
GTAACAATTATTCTTATCCATCTCATGATTCATCACCTTTTTTTAATTCA
CGAAATCTAAAGTAGTTATGTATGTAGTATATAGCTTAATTTGTTTTGTA
TCCTCTGTTTTTCMCCTGTTTWGGTCCTCTGTTCTTCCCCTGTTTTTGTT
TACTCTGCTTTGTTGCCTCTTGAATACAAACTTCATTACTAACAAAAAGT
GAAGYTCTTGGTGTTTATTTTCTTAGGCTGGCAAAACTATCCGAAGGCCA
TTTGATCGACGGAAGGCTAGAGTGTTTGTACCATGGTTGGCAATTCGAAC
GCCAAGGAAAATGTGTAAAGATTCCACAGGTATGTTTGAATTATTAGTAT
TCTAGTTAATCAAAAACATTTCTGTTTCATATTATATGARTCCCCCTCTT
AATTAATTTCATGATCTACACTAATTATARAACTTAATTGATCTCTGTTT
TCTCTAAACAGCTTCCATCTGATGCTAAAATCCGAGAGCAGCTTGTGTTA
AATCATAYGAAGTGAGGGATTCTCAAGGCGTTGTTTGGGTGTGGATGTCT
CACAAGACACCACCAAACACCAAAAAACTACCTTGGTTCGAAAACTTTGA
TAAACCCGGCTTTGATTATTCTTCGACAATCCAYGAGCTCCCCTACGATC
ACTCCATTCTTCTGGAGAACCTCATGGATCCAGCCCACATTCCAATCTCA
CACGACAGGACAGGTTTCTCAGCGAAAAGAGARAAYGCGCAGCCACTGAG
ATTTGAGGTGATTGAAAGSAGTGACAGAGGTTTTRCAGGGTATTATGGTG
AGGCAAAAGACCAGCACTTGCCTTTTTTCTTAAGGTTTGAGGCACCCGGC
GTTATCGAAAACASGAGGGAAATTGTAGACAAGAACGGTGAGAAGCACTA
CTCTGTCGGGCTCTTCCTCTGTAGACCAACGGGGCAGGGAAAATCCGTGG
CTATTATGAGGTTCGGAGCCACGAAACTCTCCCCGTTGGCAAAACTGTTT
CCGACTTGGTACTTCCACCACATTTCTTGTACAGTTTTCGAGCAAGACAT
GGGATTTCTCTCGTCTCAGAACGAAATACTTTSGAGARAAAAACGTCCCA
CGAAAGAGTTGTACCTTAATTTAAAATCATCTGATGTTTGGGTGGCAGAG
TACAGAAAATGGGTTGACARAGTTAGCAATGGCATGCCTTACCATGTAGG
TCACAGCACTATATCGTTGCCCGAAGAGGCGGCCGTGGTGGAACATGCAC
CGGCAGGGCTTGTTGCCAGTGTTTCAGCGTCTCAGCCGGCTAAGGGAGGC
GTTGGAACGATGCATGTTCCGAATTGGAGCAACCGATATTTTAGGCATGT
GATTCATTGCAAAGGGTGTAGAAATGTTGTGAAGAGTTTTCGGGTTTTGA
AAACCGGACTTTYGGGAGTTGCTGCTGTGATGGTTTTGGTTGCGATTTTG
GTGTCCGGGAGGCAGTGGAAGGCGGTTTTTTTGGTGGCGGCTGCTGTGTT
TTCGGCTGGGGCTTATGGTTGCTCAGCCGCTGTTGCATTGAGTACTACTA
ACTTCATAAGGTTGCACAAGAGGTTGTGATTTATGAGGTGATCAAAGATT
CATATGTTAAATTATGAAATATTAAGAAAGATGTTTAAAGTGGACAATAG
GGTACATGATTGACATTGTGGTTATTGAGTACCTCATGTGTTATATTCAA
GTTTCCATATTTTAGAATATCCGAAAGYGAGTAAAAATATTKTTTAAACC
AATCTTTAGTAAAAATTTAAKTGGAGTTTGAAAAAGTACTTTYAAACGAG
CYAATTATTTGAGCTTTGTCTTGCAAGTTCAATTATAASATWTGATATAG
TCATACACTTTTTTKKTTTTKTTTTGCACTCTCATGTTTACTTTTGTCAA
CTGATTTTTTTTTTRATTTATTCAATCGAAAAATTAGAAATAACATAAGT
CTGCAAGAGACGAATATGAGTGCGAAAAATCACTTCTCCAATTATGTCGG
TTTTTGTTTGCTTTAAAATACATAAGTTTACATTTGAAAWTTTKTTATTA
AAATTTTAAAAATGTYATATCGCACTYTTTATTTATGAAGACRTAGAAAT
GATACACTGTTTATGATAATTTTGAAATACTAAATAAAAAATATATTAAT
ATACATCAAATCTGAATTGAGCATAACCAAGATGGATGGAGTAATATGCT
TCTACATTTTCCCTTTAGATTAAAATTCTCTCTCTCTAATGAGATTCAAG
ATCCATGATCTGGCAGCTTTGAACTTTGAAGACATTTGAAGTGGGACTTT
CACCAAATTCAACAAATTGGGAARAAAAAGCTCCTCCTAGTGGATCCCAC
CAAGCGAGAAAGGAGATCGAAGCAGGAAAAAAAAAAAAGRAATGGCCCAT
ACAGGTCTCGAACCTGTGACCTTCGCGTTATTAGCACGACGCTCTAACCA
GCTGAGCTAATAGGCCATTTGGCAATACTGTCAACTTCTACMTACTTCAC
GYATATTGGTCATACAGGGTGAAATTCAAATACTGCAGCCCAACAAAGTT
TAAAGCCCAATGTTTGGAAGTTCCGGAAATGCTTGAGGCCATATCTACTT
GAAGACGATCACATTTWTTTTATTTTATCAAACAATAGATTWATGTTAGA
TTAGCCACCGACGAAATTTGAACATACGTCGTTATGCAAGGGCTTAACTT
CTTTCCACCGTTGTGGTAAAGGGYCACTTGYTGAACTTTTTCTTTGGAGT
AACCTCATTTGACCATCTAAATTATTACTCTAGATGAAATTGACTTCTAA
ACTACTTTTTWAAACTTTTKWAAACTACTCCTTGAACTATTTGAAACTAG
CCAATTAACTCTTTACCATSAGATTCGATAAAATTCATCTACTTTGTCAT
CAAATATTAGCTCATGACCAGTATGTGATTCAYTCTTGAGGGTAAAGTCT
TGCCAGTATTTGACAGTGAAGTGTATGAAATTTCATTAAAATCTTATGGT
AAGGKGGATAATTGACTGATTTCAAAATATTTCAGTGGCTTAATTTGTTA
AAAAAATAGTTCAGAGAATCAATTTTAACTAGGGTAATAGTTTAGGGCGT
CAAACGRCAATTTATTTTTTTTTCTTTWTGATTATAAATTTACAATSAGT
TACGTACTTTTACATCCRTGTGATTTGAAATTACAAAGTAATGGTACTCG
ACCATGTCAAGGAGAAAAGTAGCCTTTRAAAGTATATKAGTCGCAATGTT
CGGTTTTMTGTTTMTCACACAAGGARAAAAATCAGCAACATTCACAAAAG
CATGAGACTCATGYATTGGGGTCTCATTGATTTCAAGTAATTCCCTCTCA
TTGTGAAAGCTGCATGAAACTCCCTACAATTTTGTCTCWTTCAACATCAA
TTAATCTCACTCAATGCRAAAGCTRCCTTAAACTCGKTCAGTCATACCYA
TTATCTTCATGAGAAGTTGGGTTTGTTTGTACTATTGCAATGAATRTTGA
GTACCAAAAAGAGTACATATGTAAGAGAAACACATAAGCTARCTAGCACT
ATTTCTTGTTGATTGACCACACTTCAAAGATTGTGTGGCTAACATAAGTG
CAACAAGCAAATAAGCAACCCCCAACCCRATTTCACTCTCTCGCTCCTCC
CTTCTCTCTMTCTCTCTCTCTCTCTCTTCTCTCTCTCTCTCTCTCTCTCT
AGAGTCACATATTTACATGGCTTTATTTCCTCCTTAGATTTCCCTCTTCC
TTTTCTTTCAATGTCATCATCTTCCTCCTCCTTTGCTTCCTCCCCAATTS
AATCAAACATGGCTTTATTCCACCCCTTTTTCTCCCATTCCACCTCCCTC
CACCTCCACCAAACCCCCAAGCAATCACAGCCGCTCAAACTCCTCTTATC
TCTCTCCYCACCAACCCATCTCAGACCCTTCATTCCTTCCAGAAARATTA
GCCTGAGCAGCATCAAGTGTGGTGCAGTTGCAGACACCAAACCTCCTCCC
CTGCCACTTGAYGGAGATCAGGCGCCCGCAGCGGAGGAGGATCACAAGGT
CATGGTGGGTCCAACCAGCGAGGCGGAGAGGAGGGGAGAGAGGGTCGTGG
CGGATTACGATTGGACGGAGGAATGGTACCCGCTGTACCTCACACAGGAC
ATTCCARACGATGCTCCTCTGGGTCTCACAGTGTTTGATAGGCAGCTCGT
CCTGTACAGGGACGGCAATGGAGAGCTCCAGTGCTACCAGGATCGCTGCC
CCCACAGGTAACATTGTCTGTTGGTTCTAGATTCTTATATATAAGCATGC
AAATTATTTTGGGGGGGGTTTAACTTTAATCCTTAAAAAATATTGAAATT
TAAAATAAAGTTCGTGTTAGATTACATATTGATTATAATTCATTGATGTG
TTTTTAATTCAAATTAATTAATGTACATTTTATTTAATGTCTCCCATTAA
ATATTTAAATTTATTAATATACAAATTTTAATTTATTTTTTGACCAAAAA
AAGTTTTTTAATTTATTAATTTTATTTAACATTCTTCAAACTTGAAAGAC
TCAATTAATGTACCAAAATGTTAGTACTGAAATGTATTATATTGAACTAA
TGTATTTAAATGTTAGTACCGAAATTTATGCACCGAAATATATTATATTA
AATTAATGTACCTAAATGTGTGTACTAAAATTAATGCACCGAAATGTTAG
TACTAAAATGTATTATATTGAATTAATGTACCTTAATGTTTGTATCGTAA
TGTATGTACCGAAATGTGTGTAGCTGAATATATGCACCAAAATCTATTAT
AATGAATTTAAAATACCTAAATGAAGAAGACAAAGTACATCATAATATAT
TGTATAACAAAAATTAATTTATAAATGTTTATAATAAAATATATTAGGAT
AAATGAAATGAAAATTATAATTATAATGAAATAAAATTAATACATTAAAA
ATTAGGAAGAAAAGAGAAATAATTCAAAATTCAAAATATAATTAATAAAT
GAGGTTATTAATGTATCAAAGGACTAAAATTAGATTTTGATCTTACTCAT
GGTTTTAATTTAAAAGTCATCTTTGCCAAGGATTAAAATGAAATTTGTTG
TTTGAGTCTTAAGTGACTAATTTAGAGTTGAAAATAGTTGTTAGTGTTGC
ATTAACTTACTAATTGGTTAGCGCTCGTAGATTGTGCATGTTTATTTTGT
AACCTTTTTTTCTTAATGTATGAAAGTTGTTAGCGTCGTATTAACTTGCT
AACTAGTCATGACTCGTGACTCATGACAATCCTCTCTTAGCTAGGTTGGC
GAAACTATCGGAAGGGCAGCTGATTGATGGAAGGTTGGAATGTTTGTATC
ATGGTTGGCAATTCGAAGGCCAAGGAAAATGCGTAAAGATTCCTCAGGTT
TGCGRCTGTCTCTYGAGCTAATTACRCATTGTTAAGTGAGAAAYTCAAAA
TGCATGGCAATTCGTGATTGATTTGRGATACYGTCACAGGCATACAGTGA
CAKACTCTTTAATCAATGTCGGTTTATGATGTCGAGTGTGTGTTTATGTT
TTTGTATTACAGCTTCCGGCTGATGCCAAAATTCCGAAATCAGCTTGTGT
GAAAACATACGAGGTGAAGGACTCACAGGGGGTTGTGTGGGTTTGGATGT
CTCACAAGACACCACCAAACCCGGCCAAGATTCCGTGGTTTGAGAACTTC
GCCCGGCCAGGGTTTCAAGACACGTCGACGACTCATGAGCTGCCTTACGA
TCACTCCATACTTTTGGAGAATCTCATGGATCCTGCCCATGTWCCGATCT
CACACGACAGGACGGATTGGAGTGCGAAAAGGGAAGATGCTCAACCACTG
TTCTTTGAGGTCACTGAACGAACTGATCGAGGATTCGCAGGCTGGTGGGG
CAAGACRACTGATCCKTCGGGGAAAAGCTTCTTGAGGYTTGAGGCACCAT
GTTCTCTCCAAAACAACAGAGAAATYGTTGATGAMAAAACTGGGGAAAAA
CACTACTTTTCGGGTCTMTTTCTCTGTAGACCAACTGGACAAGGGAAGTC
YATGCTCATTGTGAGGTTTGGTGGAACGAAAAGGTCCCCAATCGCGAAAT
TGTTTCCAAAATGGTACTTTCATCAGAATGCCGGCAAGGTTTTCGAGCAA
GATATGGGATTTCTATCGTCGCAGAACGAGATACTCATGAAAGAAAAAGT
ACCAACCAAAGAGCTGTACCTGAACCTGAAATCTTCAGACACTTGGGTTG
CTGAGTACAGGAAATGGATGGACAAAGTAGGGCATGGAATGCCTTACCAT
TTCGGACACAGCACAATCTCGTTGCCCAAAGAGCCTGCTGTGGTGGAACA
CGCACCTGCCGGACTTGTAGCCGGGGTTTCTGCATCTCTGCCGGCAAAGG
GGGGCATCGGATCGATGCACGCTCCAAACTTGGCCAACAGGTATTTCCGG
CATGTGGTTCACTGCAAAATCTGCAGAGATGTTGTCAAAGCTTTCCAAGC
ATGGCAAAAGGCAYTCACTGCTGTTGCTGTTGCATTCGCTGCATTGGCAA
TTCTCGTCTCCGGAAGGCAGTGGAAGGCCATTCTATTAGTCTCGGCAGCG
ATCAGCTCAGCTGGGGTTTATGCGTGCTCGTACGCTGTGGCATTGAACAC
GACAAACTTCATAAGGACGCATAGGAGATTGTGAGCCRTSGATTCCATGC
CAAGAAGACGATTTGAAATTATAAATCTGTACTTTTTATACGTTTGGATT
CTCTTTGGTAAGCTTAAGATCCCGCAWTTGTTGTGGCTTTCTCAAAAAAT
TATTATRGCCGAGTGGCCTAACTCACATCTGCGTTATCAGATAGTTTCAT
TATCYTGTGTACCTCGCTTGCAAACGAAACTCTCGCAGCAGCGATCGTTA
TAGATGGTACAATTGAAGGTTAGGGAAATACATCAAAACTCCCTACACAY
ACTCTTTAATCATCTTACATATGCCAAAAAAAGGATACAGGAGAAGGACG
CTGTAGGTAAGCGCCAAATGAACCGGTATATGATATCAAGCCATGCAGAC
AATGCATGCTTTTCCCATCGAAATGATCTTCAAGCTGTGGTGTCRGTCGT
GTATGGCATGGAAAACGAATGGTGCGTAAACTGGATTATCTCAGATGTTT
TGTGCAGATCGGGCAAAGTACTCGGAATCCTTGGCAGTCCAACCGAAAAA
TCAGTGCCCAAACTTGAAGTTTGGGATGAAACATCAAATTCGACCTTCTC
GAGTGTCTGGAAGAAACAAACAATTCAAGTTTACTCATTGGACAAGAAAA
CCAACAGGACCTTCTAAATAATGACATTTAGAAGTTTAAACCGTCAAAAG
TTTAAAACTACCTGAAGAGACTGCTTGAAAACCTCGAACAACTTTTCGTT
ACGTTTYCTTTTTGAAACAAGTTCATCGTGCTCCTTCAACAGTTCATCAA
ACATGTTCTCTCTGCATAATTAGTGGAAGMAAATCACCCTCGAAGTTTTC
AATCAACAATATGCAGCAAAACCAACAGAAACACAATCATGCGGGAGATA
GAGTAATTCACAGAAGTCCTGCCAGTAATGGCCGGAATAAGGACCGTAAA
TTCCTCCTTTTCAAYAAGACATACCTGTACAGTTTTTGAATAAATGCTGT
CTGAAGGTTCTGTTTTGTAGAATTGACCTATGCCACAGTAAGAATGAAAC
ATATCAATGTATTTCAACAGTAACCGTAATATAAATATTAACACAGTGAA
AAAGGAGGAAAATAGGCATACCAGAAAGTGCATTATAGCTTTTGGAACTA
GGTCTTGCATGTTCTTTCTGACAATGTCATAATAGGATTGCAAGAGTAAT
TTGGTTATAATAATTTCCGCTGCCTCATTGTCTGTCGTTTCAGTTGGCCT
TAAGATGGACGGTGGCTGAAATCAGCAGGGACAAAGGGAAAAGCAAAGGG
ATCACATTTAAATCCTCAAATGAAAAAGCAGATAATAAATTAGAATGAAG
AAATAAAATTCTGTAAACTACAGATTTACCTCTCTCAAATTGATTGTAGA
GGGCATTGACTCCGAATGACTTTGTTCACCAAAACGTCYGCCAGACTGTA
CAGCTGATGTCCTACTCCCAAATATAGACGGAATACCCCAAGTCCTTGTA
GAACCTGTTAACAAAATTCATTGGTCTTAGCAATGGCAGATTAATRGATA
GATGTGCCATCATATATGCACAAGAAACATGTTAACAGAATAAAGCAGTT
TCAATATACCAAAGGCAGCAGTATGCTTGGAAATAGTAGACATGAGTTTA
CCAGAAGATACTGGATTCTCGTTATTCAGCTGAGGACGACTTCCCTGCCA
AACACCAAGACTATATTAGATTGAAGGCATCTATGGAAGAAGAAAGATAA
GCCAAAAGCAGCAAGGCCCTCCAAACTAGTTAATCCACAAATCTAATTTT
ACCCCATTTACTTGGATTCACAAAAGTGTTTTTAGGCTTTTAGCCAACTG
RAAAGCTGATTTAAAAGGAAAACAGTGCTCCAAATTACAGTTTTCTTCAC
AAACAATCCAAATCTGATATTTCAGGTAGAGAATGAACTAGTTAGAGCCT
ATTTTTCATGCTAAAAMAAAAAAAAAAGACGAGCAGATTTTGTTCTTCAT
TCTAGCACTATGGGTGGCTCCAGCGTTTGTCTCTACAAGGTTCAACAACC
CCAGTCTTCCACTATCACGCTTCTACCATTAGCTAGGTTAATGGAACCCC
ATAAAAAGAAGAAATAGCTAGGCTAATGGAAGATCATAACAATTCAGGTG
ATATGGGCCCCAAAGAGTAAGCAAGGACCTCCAATTTCTTAAGGGCCTTT
CTTCTATGGTTCTGGGGGGTTGTTCTCCCCTTTCTGTTTTCAACTCTGCC
ATCCTTTTGTCTTTCCTTTCTCTTTTTGTTTGGACTACCCAGTTTCCGTC
TTGTAATATTGTCAACTAAAAATGAAAGGCATACTTGGTAAGGTAAAATT
CCATTCATAACTGTCTTAGCCTGAACAGTTCGAGATGTCTGGCCTTCAAC
ATCCGTAACACCCTGAAACATATAAGAACAACTTTGAGGTATAACCGATA
ATTGACAAACCCTTTTACATGAGATCTAATGATGATTGGGTCGAATAATA
GTGCAAAGATAATAAGGAATAAAATACGTTACCCTAAAAAAAAAGGAATA
TAGCATGCAACCACTCTAAATTTATTGATATGAACTTGATGATAGAGATC
AAACAAAAAGTTCTCTTGATAAGAATGAAGAGYCAAATCTCAATAACTTT
TTCCTTTCTCAAAATAAGAASGAAAAACACACTAAACAGAGATCTCTGTA
YACTATCAATAAAAAATAAAGCCACCACTGTATAGTTTGCCTTTCTGATC
TTTCAGATCATATCAAAACTGAGATTTCATATTCATAATTGACTTCGGTT
AATATGACAGGACTTTTGTTATAAAAATAAAACATAGGACTGTTAGATTA
AAGAAACTAAAAGTTCATGACAACATATTTGTTATGAATCCAACACACGA
TCAGGACTGCTTCATCGTGTCTAWTAGTAAAGCAGTAACTGTTTAAGCTA
TTTTATTTACATTATTATCATCCATTTCACCAATGTTGTAGAAGATACCT
TTTGTGCTTTCAACTGCTGCATAGCAAGCTCAGAAGCTTTCTTCCCACCT
ATAAAACGTGGATGCGAAGTGTTTATATAATCCACCTGAATGGAAGAAAG
TTGGGCAATCAGCATTTGAGTAAATGTGAAAGAAATAAAACCATAGCATG
TAATTCTGAGCAATCTCTTAAAAGAAAACATATATTGTCAGTGAAGAGAT
CAGTGCCGAGCACAATTTTTTGTGACATGACCAACAGATCTAAGAATTGA
TCACTTTTGTGGAGCCAAAAATAATCGAGAAAAATATGGAGGTGACACGT
GGATTCTAGGGTGAAAAGGATAAAATTACCCTCGAGGAATACCGGAACTC
CTACACACGAGCAGTGGACAATCATGACTCAATCAAGGTCAAAAGTGCTC
AAAATAGGTAATTATTCAAAACCTATCTCATCCATCCTCATCAAATCTTC
TCCACAAGGTAACCCCCAAATCATTCCTTTCAAATTTTATTAATTAGCTA
ATTAATTGATTTATTACTCAAGCCGACATTCACCTCTCCCATACCCTGCG
TAAAGCGGGAGCCTTGTGCACTGGGTACGACCTGAGCTAATTAATTGATT
TATTACTCAATTAATTTATTAATTGGCTAACAAATTATGAATCACACCCA
AAAACCATCCAAGTGGCCGGTCCCCATCCTCCCAAAGGGGCCGGCCATAC
CCCTATAAATTCTACCTCATTTTCTCCAAAACTCAATTCCATCTCTCTTG
CAAAACTCTCTAAATTCTCCAAACACTTTTCCCTCAAAATTCTAGCTTTG
GCATCGGAGGTTTTTCGGCCAAAGCCCGCCCCCCCCCCTTCATTGTAGGC
GAGTGAGGCTCTTGGCCTTGACCTAAGGTGTTATTTGTTTTGTAGGTGCA
ATTTTGTCCAAGAAGAAGAAGACGGAAATTTGCATCCACAACTTTCATTT
CAAGAGTGTCAACAAACCATTGGTAGTAAGAGCCACCCAAAAACTAAATA
AAGGGTTGGCAAGAAATATAGGATATCATACACTACAGAGTTGAAAATTT
ACTGTATTACCAAAATGTTAAAATCACCTTTTTTTTTTTTTTAAAGGGTT
GAGTGTTTTACCAGTTACTAWTGTCAACTCAGTGTGATTAGATTTTATAT
TCCGCTATTTTAACATTATTTTGAGAGTGCATGAAATCATTTTAACAAAT
GCTGTACATAATTTTTAGTGAATAAACTTTAGTCTTAATTTTTCTAGGTT
GACAAAGAGCTACCTCCATCTCAATAAGATTTTCTATCATTCTCAGRGCA
GGCTTTGCCCCTTCCCGCAAAAAGTTTACCACGAYTTCATCCAGACACTT
TCTCAATACTGGAAACCTTTGCAACTCAATTACCTCGCAAGCGCGGCTTA
TCTGCAGGGAAAATTTTATCTTACTGATTATATTTACACCTCAGGATTCA
TGGACACGCTATAAGAATTCCATAAGCACCACAGGTGCATAAATCATATC
TCACCTTCACAAGTTCATCATAAACAAAATGAAGACACTGACAGCTTGGG
TCTAGCAACCGAGCAATTTGTCTTCTTACTAAAAATTCAAATGGGACCTA
AAGATAATTCAAAAACATATCAGGCACTGTGTAGAACCAAAGGCATGGGC
GTCTACCTTTATGCTAGGGAAAAATGCAAAACTACAGCATGTAATCATCA
TTAAACTCACCTCAGGCACAAATAAAGCATTTTTTGCACCAGAAGCGTTT
TGAATAGCYGTTCGAATATCATCATCAGTTAGATCGTCGCAGGGATCCAC
ACCCTACAATTCGTGAGAGTTAGTAGCCAATCTGATGGTACATGTCTCAC
AGTGGAACATTAGTTCTACAACTCGGTGCCTTGATTACATATATAACACT
ACATAGTTTTCTTCAAGACAACCTTCAAGGTATGCTGACATCAAACAAAT
AAGCAGAAGACAGCAACTGACAACRTAGTAGTCTATGGCTTTAGATTAAA
ACTTACAAAAAGAAAGAAAGCAAGAATTTGTACCTCCAAGCTTTTTACAA
AAATTGACTGGAGAATGTAGTGGATCCTAGCACCTCCTGATAATTCTTTG
GTTGACATCTCCTGACTTTTTCCCTCCAACATGGCAGCAAAAGCTGTCCA
TTGGTGAAACAGAGAGAGAAGAAACATTAACATCATCAGTGAAAACAGCT
AAAACGAAAATAACAACAAACAAGGTAGTACTTGAACAGCATGCTCTATT
AGCATAAATGCCCTAAAAACAAGTTGCTTAAAATCATAAAAAACCATGAT
TACACAAATTAAAGAAGACTAGAAGACTTTAGAGAAAGGCTTTCACTTTA
CGTTAATTTCAGTTGGGCCACATGGTTAAGTCCATGTGACATCATTGGTA
TTCTCCACAAACGTATAGTTTCTCGGGTCCAGTAAAGTTCATATGATAMG
GTAYGTGTACTAACTTAGTCTGTGAGAAAAAATTAGAGAAATTAAATTTA
CWGTATTACTATATCTCACTTGTGCAAATTGTTGTGCATAACTCGTGCTG
ATCCTCAGCGTCTCTTAATAAAACAAAAAGAAAAGATGGGGTGGATTTCC
TTCCAGCTCTACTGCACCCTAATCCCATTGCAGGAATTTCTTTTCACTAT
CACATGCTTCACCACCAGTCACAGAAACACCTCATAGCCTTCACTACTAA
ATCCTCTCCGAGAGGTTGGCTAAGGTAATACAGTACTCTCTCCCTWTGAC
AAATATAGATCCAATTCTTKGGAAAAAAATGCTAACAGAATCAAGAAAGA
TATATTAAGTGATACTTTGAGGTATATCATCCATGATTCCAAGGCATGCA
GGCAAGTGAAAGATTGACATTTAACAAATAACAGAAATAGAAATCTCACC
TTCGCAATATTTTGTTAAAATGTTCAACAAAACCACTCCCTGCGCCATCT
GGTTCAGGACAAGTGACAAAAAATTGTTACAAACAGCTAAAAAGTGAAGA
GTGTACCATCTATGCCAATAACMAGAGAATAGTTTTTGAATGTGAATGCA
TGTGTCTATGCACTTCGCTATGTGTTCCATCAATACTAGCAAAATATCTG
TATAGACTGGTCATGAATATAAATAAAAAAGGAAGAGGACAAGGGGACAA
GGGRACTGGACTTGGACCTAGTGTTTGGATGCGAATGCAACACTTCAACC
ATTTAGGAATCAGTAGTTTTCTAACTCTCTGCATGCATTAAATGCAGTAG
ATAATACCAGCCCCTGATAAGTTGTTTTGCAACTTACTTTAGATTCTAAA
GGTTGCCCATATGCCTGCAGTTCTTTGGAAACAGAAACCATTTGAGAATT
CAACCGAGCCTTCAAATCAGGGAGAACCCTTTTGATATGCTGCTCCAGAA
TCTAACACAGAAAACCAACCATGACAACAGTGCAAAAACAAAGAGAGTAC
AAMWTAATATAAAACAAAAACAATACATAAGCACCTAAGAATTTCATTTC
CCTTTAGTATAACTTTGTTATGACTTTGGTTCATAGTTCATACCGACCTG
ATTCAGGTTCCTTGCTAACTGGGGCATGCCGCAACGATCCGAGAGGTTAC
TATACACCTTTAACATGTGTGGCATACAAYAAATGTTAAGTGCCAAGACA
AACAATTATCATTATTTTCRCAATATAATGTACAAAGAAAGCAAACAGTA
CAGGGTGCTCATTGAAGAATTTCTCCTCGTATGCAAGTGCAGCAGCAATC
CCACGGTTTTTATTGATGTCCTGTGACACAAGAATAACACTTAAGTAATA
GAGCTTGAACCTTGCACCTGCATTTTCTTCTATAACAATAACATTTTAGC
AATGTACTAAATAAAACAAAYGTATGCTACAATAYAYACATACACACACA
CACACACACACACAYAYAYATATATATATATAGATACATGTATATATAAC
TTTAGCGGAACAATTCATACCTCCTGGCTACGATTCACAACACCAACATA
ACCRAGCTTTAGCGGAATAACTTTCCCAAGCAAAAAGTTACAGGCATCGG
TGCCCCTGTCCATTATATCAAGCTACAGATAGAACAACATTGTCATATTG
TACAACAACTGASGCGTTTAATAAACCGGAGTCTAASASGTGAACCACAA
ACCTTGGTGATCACACCGATTGTGCGGAAACCTGTTAATAMATTTATGTC
AGTACATTATGCATTGGATGTAAAAGTCGAATTCAGAAGTAAAATGTGCA
GGTACCATTYGGGTCGGCTTCTCTAGCCATCTGAAGCGCATCGGAGGTTG
CCAAATCGGAATTCGCAGGACTAACAGCCAAAATAATACAGTTTTGCTGT
GTAATATAGTCCATAATCATCTTCCTAATCATTGCTTCTATGTCTCTCGG
TTGATCTCCCACCGGAACTTTCGTGATTCCGGGCAAATCAACCAGTGTCA
TATTAAGCACATTCGGAGAGGTAATCTTCAGCCGGATTTGCTTATCCGAA
ACCCCTTTGTTCAATCCGGCCTCCCTATCCGTCTCGGCCTGCGCCGACAA
AACAATTATCAAAAAAACAGTATAACTACTAGCAGCAATGCTGAAGAAGA
AGCTCAATCCGTACCTGAATTTCGCGGCGGATTGCGGAGAAGTCGTAGAA
GCGTTTTCCGGGCAAGTGGCGGAACTCTCCCCACTCGGTGTGCTCATCGC
CGGGTTCTTCCGCGCGATACTCGAGCATCAGCACGAGCGGGCGGCGAGTG
CAGATGTCRCGGCCGCGSGGGAGGAAGTCYCGGCCGACCAGGGMTTCGAG
GACRCTCGACTTCCCGCTGCTCTGGCTTCCCACGACCGCCACCTGAGGCA
GCGAAATCTGCGGCTTGTCGCTGACCACCGGCGCSAGAATATCCTGGAGC
TTGTTGATCATCGAAATTAGCGACGAGCCGATCGTCACTGAAGGTCTCGG
ACTGGTTGCCGAGGAGCCGACTTCCCTAGCTTCTTCTCCCATGGTGCGGT
TTTAGAGAGAGAAAACTTACACTCTGATTACAGAGAGTGTGGCAGAGAGA
GAAAGCAGAGTTACAGAGAGTAAGGTAGAGAGAGAAAGAAAAGAGAAGGG
GGGAGGGGGGGKTKGAARTTRGAGGTTTAAAGCGTGTACGACAGTTTAGC
TGGTGGTTCTTGGAGGAGAAGGAAGCAGACCGGAGGTACTGATACTGTTT
CTCAAAGAAAATGGTGGGACGCTTTTCTGTGTATTTTGGGTTTAGATGAG
GGATGCGAGCCGTKGGATCTTAAGGTACACTGAGTCACGAGTCACCAATC
CCACACAGGATCCTCTTACATTTTGARAACTTTAACTAAAAATCTACGGT
ACTGTTCATTTTAACGAAAAATCACATTTTTACGCTAAAAAGTCAAGCTT
AGTTTTTCTTTTTATTTTACTCTGGTTTGAAATGAAGTCCAAGSAAGGGA
AYCRGATCCCTTCCTCCTAATCCATCAAGTTCGGRAATCCGGATCATTGA
AATTTGATCCAACGAYTACAAATAARAGCCCACTTTAAAAGTTATAATWW
WTTTTACCGTTTGATTAAATTTCAATGGTCCAAATCCCCAAACTTAATGG
ATTAGGAGGCAGKGGTGCATCCCTTTCCGAAGTCCAAGGGCAACCTAAGT
GTTCTTTTTTGGTTTTTTACAAGTGATATAAAACGCTACTTGTGAAAAGT
GTTTTCATATAAYCAAAAGTTTTTTTTTTWTTWTTTTTTATTTTTACTGA
TGTGTGTAAAATAATTAAAAGCACTTTTAGATGAAAAGCACTTTGAWWTT
TTTTTTTTTTTTTSCCGAAACACACTGATGAAAAGCTTTTCGAATGAACT
GATAAACGACTTTTGAAATKATTGAAGGAGTTTTCGGATGGTCAAAGCAC
TTATGGTAATATTTGTCATAAAAGGTTAAAAACTTAAAAGTCATTTTAGG
AAAGCCARTAGCATGTGCTTTTTTGAAAGTCCATGATACAAGYRCTCACT
TGCATAAGTGCCTTATAGAGAAACATTTTCTAAAAACCGGACTCGTTTGA
GAAGTGCTTTTAAAATTGTTGAAAGCGCTTTCCATTTGACAAAACAAAAC
TAAYRGCATTGAGATTTTAATAACAACATAGTTARTCTGGGGGGGAAAGG
AGATCAATGTATGTACAACAATCCAAGGGGTCAAAACGCATCCTACACCT
ATGAAATTTTCGAAGTAAAATAAAGTTTAGCATACATTATACGCTTACAA
ATGATGCACAAGATAATACAAAGGCTAAAATTTAAGCCATCTCTTCTCTT
TTTCCTTACTGACAACCGCATTCGACGCAGACGCTTGAGCGGCCTCTGCC
TGTGCCAAAGCGTTGCGAGTCTCCGTCAATTTCCTCATCGCAGCATCATA
AACCACCTTCTCATTTTTGTTTCTAATTGCCATTTCTTCAAGCTTCCCAA
CTCGCGCCTTCAAGTCCTTCACTTCATCATCGTAAGCAACCAAAGCCCGC
CTATCAACTTTCTTTCCCTCCCCTGATCCATTGCTCTGCTGCTTCTTCGC
TGATTTACCATTCAATGCTTCACCGTGCTTTGCAAGTTGGCTATTAATAA
GACTAAAGACATCTGGTGTTGATTCCTCTTCTTCTTTTGCTGCTCTKGCC
AGTGCTGCAAACTTCTTTTCACGCTTCCTCTTACCACCCCTGCTACGCTT
CTTTCCTTGATTCTCTTTGCTCTSTTTACTMTCTTCRCCTTCACGGGWTT
TGACWGCATGATCRAGAGATTGCTTTGGCGGAAGGACCTTCACGGAGATG
GGATCTATAATTCCCTGGCCAGATGCACCTAGACCAGTTCCTTCAAGGTA
ACCCATGTTGGCCATCATCCTGGACGCTATGCCMCGGGTGTGGTTCTCCC
ACTTTGCAAATATGGCAGTTTCTGTCTGAATACCCCTCTGGAGGATTGTG
CTTTCAAGAAATCCTAAACCCTGYGGGGTTYCATCTTCATAGTCACTAGA
ATCAGATTGGTCAGAGCTTGAATCACTTTCTTCTTCATCRCTCATCTGAG
CATGCTCGGACAATGTTATAGCRTCCTCCCCAAGATCTGCAGAGCTTCCA
TCATCTCGGAATACAACTTTTCCAACCCCAAGTGCACCGTCCCATGATTC
AAGTTCAGCTTCCCTCCACACACCAGTTTTACTATCTGATACTGCCCAAA
TATTAGACCCGACCAGTGACTGCTCCCATATTGTCGGGATATACTTTCTC
AGTGAGGAAAGTGGGACATCAACTCCTGCATGCATAGGAAATGGGTGAGC
ATGGAGATTCTGAACTCGTTCCGAAAAGCATAAGCAGTTCTATGAAGCAT
AAAGGAAAAGGGTGCTTTAWCTTCTGAAGCCCAGCTAGGTACGGCTACCA
ATCTAAAATATAGCCTGGCTATGAGCCTATGACCACCAATATYTCATACC
ACGCATTGTTCCAGAGGCTAATAACAATGCAAACATGGCATCAGTGGGAC
CATAGACAAGCTATCTGTCAATAGATAACAACATACCATGTGATAAGCGG
CAGTTGGTACCAAATCGACATCGTTGTTGAAGAAAGAACTTGCAAATCTG
CATTTTGATGGTTCAGCATTAGTATTTTTAAGTGGTTATATAGCCTTGGC
TTATTGACTTTGAAGTGACACACCATCTCCACCAGGTTCAACCTTAAATC
AAATGTGGGGCTTTATWTTTGTAACCTTGTTGCTTTGGTTAAAATTAAAG
TTTATACTCACGGTAGCATGTCCTCTCCAAAATCATTAAGAAAAAAGCTA
TAGAAACGAAAAGGAAAARTTCACGAGATAAAAAGGGGACCAGCAAAATG
TACGCACCATCRTATTCTCRGATGTAGGAGTGAGGAAAGAAATCTTTGCA
GAATCCGAACCCTCCAATCCAATAACCTGACCATTATACCAACGTCCATC
AGTGTGACGGAACCTACATTTCGACCCAACAGGGTAACTCGGGTCCTCCA
GCGGCTCCGGCTCAACATCTGTTTCTGTTAGATCAATAGTCTCCACCTTA
ACACCCTCATCAACATGAGCAGAACCATCTAGCACTAAATCAGCTTCTCG
TAATAACCGTGCCCGTTTCAGGTTCAGCAGCCCTTCCTCGGCATCTTTAA
TCGCCTGAACAATCTCCTCGTGAAGCTGCGAAAACATAACCCCCAATAYA
TGGTTTTCAAAAACCAACCTAGATTTCGATTTCGATTAAATCACCTAAAA
ACTTAWCTTCCTAGTACATTATTAACTTGCAGAGCTAAGAGCWCGATCAT
TCACATTTCAAAATTCATATCAATTAAGYTAATTTCAACTACAAAATCCT
ATCAATCTGATCCATATCAATTACAAGATAATTATTAACGGAATTTAGAC
AAATTTGGCAATAATATTGTACAAATTGAAGGCTTTACACGTTTATCACC
AGCGCTCAGCTGGATTTTATCACAAAATCGTACTCCACCAAATGAATCGT
AAAACCTAGCATTATCAACACTTTCTTTCGTGGATTTTCTCGGTAACCAA
ACAGAAAGTTTTSRCTGTAAAGTAAGAGATGAGGTACCGCGAGAAGCTCG
GTATTGCTGGGCTCAGAGGCTAGAGCGTCGTTAATGGTAGAGAGAGATTC
TCTTTGCTCTTGCAATTGAAGCTCCAGTAGGTTCTCCAGAACCCTCTCTT
CCTCGTCTGCCATGGCTGTTGTTCCGCACGCGCTAACTCTTTCTCCAACG
GTGAAACYCGTGTCGGTATATAAACTGAAAAAGAACTCGGACTCCTCCAA
TGGGCCAACTGTACATATATTTGGAATTAAGCCCAAGTAGAGTATTTTTG
CACCCCTTGGGGCCCATTGAGCCCAACTATCTCGKACGCGTTCGACAACT
CACAAGAGACGCGAGAGAGGTTCTYGAGTAGGAAACCAGATTGGGTTGAT
GAGAGGGAAGACGAGGTCAAAGTGGGGGTGGAGAGATTTTTCSGTGTGCR
GGGAATACCGCCKAGTACACYAATTGTAATAATACAAATGGTTAAAAAAT
TTACAAAGAAATTCTCAACCAAKTGTATTATGAYACTTRRTGTACAGGGC
TAAAATTTCTCCTAAGGGTGGTGTATGTGATGTYTTTGTGTATGGAGTCC
GCRCAAACACCGAACTTCARAATTTCTCKTAATACWAGTAGRGCTCGTTT
GGATGYMTTTTTAAAATGWCTGAAARCRCTTTTAGATAAAATGTTTTTGA
GTTCCAAAARCACTTTAAGTGTTTTYTTGCAAGAAGCACMAGTTATGTGT
TTTTTCCATGAAGCACTTTAAGTGYTTTTCCAGGATTTACTTGCATTTTT
ACTAARGWTTGCTTCCAAAAACWTTTTYACCAWAATTGCTTTCARTTATT
TTAAAAGYACATCCAAACGAGSTAGTAAGCTCTACAGAAGCCTCTTATAT
GTGGGTTCCACCTCAATTAGAAAGTCGTCCAMCTTCTCCCTAACCTCAAA
TTCAACACCCCATAAAGTGRTATATGTTTGTAATGAGTTTGATACTTCGT
GGCTTAAAACCGTTCATTGTTTGATACAAAAAAAAYAGTACAMAAGCTWA
AATWGGGCCTAATGTACAGTTATTTTGTMATGGGCCATAATGAGGTGAAA
TTGGGCCCTTTTCTCCGAGAAATTAAAAWGTCGAACCCGCGAAGCAAGTT
CAGAGTCGGTTGGCGCGGGTAAACTGGTTTCCCATTACTACACAGTGAGC
AGAAAACCCTAGGAGAGAGAAGGTGAAGCTCTGAGAAAATGGGRCAGGTA
AACGAGCATCACGAAGCGACTGACGGCTTGGTGAAGCTGCTGACGAAGGC
GAACCACGATCTGACGGTGGTTCAGCACCGGCTCGAGAGGGAGTTCCAGC
AAATCTACCCGGATAATGCGAACCCGATGAAGCTGGTTTCGAGGATAAAG
AAGATTCAAGAAGAATTGTCGACTTTGGAAGATCAGTGCCGCGAACTTCT
TTCCGCCAAACAGGTAATTTTCAAATTTTTTAGATAAAATTGGGAAAATT
TAGTTTTTAATTTTGATTTTTGGGTTTTGGGTTTTGAAGGATTTGATTGA
TAAGGCTAGGACGACTYTGGTTGGGAACAGAAACCAATTGCAGCGGATGG
AGGCATCGATGGGAGTTTTCGCCGACGCTGATTCGGATGATTCTGCTTTT
GCTAACTTCAACCAGGTTAATTTCTTTTGGGTACATTTCATTTTCATAAA
TGAAAATATTGGAGCTAGCACATATAGATTGATAGTTAGAGTGGATCGAA
ATTTCGTGAATCGGTCATTACACTGTACGTGATTTCTATGCCAGAATGCT
GGTGAATGCTGTATCTATTAAAATCCTGTGAAATCCAAATCGACTACACC
CCCCTTAATTTCCAAGAAATCGAAGCTGAGGATACGGTTTTTTTCCCATT
GCAATGGTAATAGAATTGTGGATTGTTGTAATCTGTGATTACAGTATTTG
TGTTGTTTGCTGTTGTTGGCAATACCTACGTGAACGGTTGTCTAGTTTTC
CAGATGGTGTTTCAAGTGTTTGCACCATTTCCAGCAAGCAACCAAGATTA
ATCTATGGCTCCTCAATGTTTCTAATTATATGCCCGTGCAAAGATATTCT
GCGGGTAGCTTTGTAGCGGAACTATGCCTGAACTATAGGGGTATTAAGCT
AATGAGTCATACAATGAAGCTCTGGGAGAGAGTCATTGAGCATAGATTGA
GGCAAGAGACACGGGTTTCGGACAACCAATTCGGGTTCATGCCAGGGCGC
TCAACCATGGAGGCAATCTATCTCTTACGAAGATTGATGGAAAGATATAG
AGATGGGAAAAAGGATTTACACATGGTCTTTATAGATTTGGAAAAAGCGT
ATGATAGGGTCCCAAGAGACATTCTTTGGAGGATTTTAGAGAAGAAAGGA
GTACGAGTAGCATATATCCAAGCTATAAAGGATATGTATGAAGGAGCAAA
GACCGCCGTAAGAACTCATGAAGGACAAACCGAAAGCTTTCCCATAACTG
TAGGATTACATCAAGGCTCATCCTTAAGTCCTTACCTTTTTGCGTTGGTA
ATGGATGAGTTAACAGGACATATTCAAGATGATATTCCTTGGTGTATGCT
TTTCGCAGACGATATAGTGTTGATAGATGAAACTCAGGAAGGGGTAAATG
CAAAGCTTAACCTTTGGAGAGAAGTGTTGGAATCTAAAGGTCTTCGCCTA
AGCCGATCAAAGACAGAATATATGGAGTGCAAGTTCAGTGCAAATGGAGG
CCAAAACGAGTTAGGGGTGAAGATCGGAGATCAAGAATACCAAAGAGCGA
CCATTTTCGTTACCTAAGATCTATCTTGCAAAGAACGGAGAATTAGATGG
AGATCTCAACCATAGAATACAAGCTGGATGGA
back to top