MDC021050.213, MDC021050.213 (contig) Malus x domestica

Contig Overview
NameMDC021050.213
Unique NameMDC021050.213
Typecontig
OrganismMalus x domestica (Apple)
Sequence length29111
Analyses
This contig is derived from or has results from the following analyses
Analysis NameDate Performed
Malus x domestica Whole Genome v1.0 Assembly & Annotation2012-07-26
Alignments
Feature NameTypeLocationAnalysis
MDP0000225641 mRNA MDP0000225641:17515..22609+ Malus x domestica Whole Genome v1.0 Assembly & Annotation
MDP0000225641_exon_1 CDS MDP0000225641_exon_1:17515..17592+ Malus x domestica Whole Genome v1.0 Assembly & Annotation
MDP0000225641_exon_2 CDS MDP0000225641_exon_2:17684..17746+ Malus x domestica Whole Genome v1.0 Assembly & Annotation
MDP0000225641_exon_3 CDS MDP0000225641_exon_3:18506..18834+ Malus x domestica Whole Genome v1.0 Assembly & Annotation
MDP0000225641_exon_4 CDS MDP0000225641_exon_4:19743..19902+ Malus x domestica Whole Genome v1.0 Assembly & Annotation
MDP0000225641_exon_5 CDS MDP0000225641_exon_5:20048..20437+ Malus x domestica Whole Genome v1.0 Assembly & Annotation
MDP0000225641_exon_6 CDS MDP0000225641_exon_6:20548..20718+ Malus x domestica Whole Genome v1.0 Assembly & Annotation
MDP0000225641_exon_7 CDS MDP0000225641_exon_7:20822..21358+ Malus x domestica Whole Genome v1.0 Assembly & Annotation
MDP0000225641_exon_8 CDS MDP0000225641_exon_8:21494..22609+ Malus x domestica Whole Genome v1.0 Assembly & Annotation
MDP0000841002 mRNA MDP0000841002:9231..10349- Malus x domestica Whole Genome v1.0 Assembly & Annotation
MDP0000841002_exon_1 CDS MDP0000841002_exon_1:9231..10349- Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_CT_12969881_Lg8_01132_MAF30_8636_exon1 genetic_marker RosBREEDSNP_SNP_CT_12969881_Lg8_01132_MAF30_8636_exon1:13083..13083. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_AG_12960273_Lg8 genetic_marker RosBREEDSNP_SNP_AG_12960273_Lg8:3475..3475. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_AG_12961114_Lg8 genetic_marker RosBREEDSNP_SNP_AG_12961114_Lg8:4316..4316. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_GT_12962081_Lg8 genetic_marker RosBREEDSNP_SNP_GT_12962081_Lg8:5283..5283. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_CT_12962466_Lg8 genetic_marker RosBREEDSNP_SNP_CT_12962466_Lg8:5668..5668. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_AC_12962587_Lg8 genetic_marker RosBREEDSNP_SNP_AC_12962587_Lg8:5789..5789. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_CT_12963094_Lg8 genetic_marker RosBREEDSNP_SNP_CT_12963094_Lg8:6296..6296. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_GT_12963098_Lg8 genetic_marker RosBREEDSNP_SNP_GT_12963098_Lg8:6300..6300. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_TG_12964481_Lg8 genetic_marker RosBREEDSNP_SNP_TG_12964481_Lg8:7683..7683. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_CA_12964498_Lg8 genetic_marker RosBREEDSNP_SNP_CA_12964498_Lg8:7700..7700. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_AG_12964502_Lg8 genetic_marker RosBREEDSNP_SNP_AG_12964502_Lg8:7704..7704. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_AG_12964544_Lg8 genetic_marker RosBREEDSNP_SNP_AG_12964544_Lg8:7746..7746. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_TC_12964573_Lg8 genetic_marker RosBREEDSNP_SNP_TC_12964573_Lg8:7775..7775. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_CT_12964619_Lg8 genetic_marker RosBREEDSNP_SNP_CT_12964619_Lg8:7821..7821. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_CT_12964703_Lg8 genetic_marker RosBREEDSNP_SNP_CT_12964703_Lg8:7905..7905. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_AG_12964709_Lg8 genetic_marker RosBREEDSNP_SNP_AG_12964709_Lg8:7911..7911. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_AG_12964717_Lg8 genetic_marker RosBREEDSNP_SNP_AG_12964717_Lg8:7919..7919. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_CT_12964718_Lg8 genetic_marker RosBREEDSNP_SNP_CT_12964718_Lg8:7920..7920. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_AG_12965272_Lg8 genetic_marker RosBREEDSNP_SNP_AG_12965272_Lg8:8474..8474. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_GA_12965370_Lg8 genetic_marker RosBREEDSNP_SNP_GA_12965370_Lg8:8572..8572. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_GT_12966706_Lg8 genetic_marker RosBREEDSNP_SNP_GT_12966706_Lg8:9908..9908. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_CT_12966708_Lg8 genetic_marker RosBREEDSNP_SNP_CT_12966708_Lg8:9910..9910. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_GA_12966731_Lg8 genetic_marker RosBREEDSNP_SNP_GA_12966731_Lg8:9933..9933. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_AG_12966737_Lg8 genetic_marker RosBREEDSNP_SNP_AG_12966737_Lg8:9939..9939. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_GA_12966740_Lg8 genetic_marker RosBREEDSNP_SNP_GA_12966740_Lg8:9942..9942. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_GA_12966743_Lg8 genetic_marker RosBREEDSNP_SNP_GA_12966743_Lg8:9945..9945. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_CT_12966761_Lg8 genetic_marker RosBREEDSNP_SNP_CT_12966761_Lg8:9963..9963. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_GA_12966820_Lg8 genetic_marker RosBREEDSNP_SNP_GA_12966820_Lg8:10022..10022. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_GA_12966865_Lg8 genetic_marker RosBREEDSNP_SNP_GA_12966865_Lg8:10067..10067. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_GA_12966885_Lg8 genetic_marker RosBREEDSNP_SNP_GA_12966885_Lg8:10087..10087. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_TC_12966898_Lg8 genetic_marker RosBREEDSNP_SNP_TC_12966898_Lg8:10100..10100. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_CT_12966914_Lg8 genetic_marker RosBREEDSNP_SNP_CT_12966914_Lg8:10116..10116. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_GA_12966968_Lg8 genetic_marker RosBREEDSNP_SNP_GA_12966968_Lg8:10170..10170. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_GA_12966985_Lg8 genetic_marker RosBREEDSNP_SNP_GA_12966985_Lg8:10187..10187. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_CA_12967003_Lg8 genetic_marker RosBREEDSNP_SNP_CA_12967003_Lg8:10205..10205. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_GA_12967004_Lg8 genetic_marker RosBREEDSNP_SNP_GA_12967004_Lg8:10206..10206. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_GA_12967016_Lg8 genetic_marker RosBREEDSNP_SNP_GA_12967016_Lg8:10218..10218. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_AC_12967837_Lg8 genetic_marker RosBREEDSNP_SNP_AC_12967837_Lg8:11039..11039. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_AG_12968642_Lg8 genetic_marker RosBREEDSNP_SNP_AG_12968642_Lg8:11844..11844. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_GA_12968710_Lg8 genetic_marker RosBREEDSNP_SNP_GA_12968710_Lg8:11912..11912. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_TC_12969152_Lg8 genetic_marker RosBREEDSNP_SNP_TC_12969152_Lg8:12354..12354. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_AG_12969834_Lg8 genetic_marker RosBREEDSNP_SNP_AG_12969834_Lg8:13036..13036. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_CT_12969881_Lg8 genetic_marker RosBREEDSNP_SNP_CT_12969881_Lg8:13083..13083. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_AG_12970915_Lg8 genetic_marker RosBREEDSNP_SNP_AG_12970915_Lg8:14117..14117. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_GT_12970958_Lg8 genetic_marker RosBREEDSNP_SNP_GT_12970958_Lg8:14160..14160. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_TC_12970969_Lg8 genetic_marker RosBREEDSNP_SNP_TC_12970969_Lg8:14171..14171. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_CT_12971040_Lg8 genetic_marker RosBREEDSNP_SNP_CT_12971040_Lg8:14242..14242. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_CT_12972016_Lg8 genetic_marker RosBREEDSNP_SNP_CT_12972016_Lg8:15218..15218. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_CT_12973314_Lg8 genetic_marker RosBREEDSNP_SNP_CT_12973314_Lg8:16516..16516. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_AC_12973513_Lg8 genetic_marker RosBREEDSNP_SNP_AC_12973513_Lg8:16715..16715. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_TC_12973514_Lg8 genetic_marker RosBREEDSNP_SNP_TC_12973514_Lg8:16716..16716. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_GA_12975381_Lg8 genetic_marker RosBREEDSNP_SNP_GA_12975381_Lg8:18583..18583. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_GT_12977679_Lg8 genetic_marker RosBREEDSNP_SNP_GT_12977679_Lg8:20881..20881. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_GA_12977745_Lg8 genetic_marker RosBREEDSNP_SNP_GA_12977745_Lg8:20947..20947. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_AG_12977751_Lg8 genetic_marker RosBREEDSNP_SNP_AG_12977751_Lg8:20953..20953. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_GA_12977877_Lg8 genetic_marker RosBREEDSNP_SNP_GA_12977877_Lg8:21079..21079. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_CT_12977922_Lg8 genetic_marker RosBREEDSNP_SNP_CT_12977922_Lg8:21124..21124. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_TC_12978015_Lg8 genetic_marker RosBREEDSNP_SNP_TC_12978015_Lg8:21217..21217. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_AC_12978640_Lg8 genetic_marker RosBREEDSNP_SNP_AC_12978640_Lg8:21842..21842. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_AG_12978669_Lg8 genetic_marker RosBREEDSNP_SNP_AG_12978669_Lg8:21871..21871. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_CA_12978690_Lg8 genetic_marker RosBREEDSNP_SNP_CA_12978690_Lg8:21892..21892. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_AG_12978693_Lg8 genetic_marker RosBREEDSNP_SNP_AG_12978693_Lg8:21895..21895. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_AG_12982549_Lg8 genetic_marker RosBREEDSNP_SNP_AG_12982549_Lg8:25751..25751. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_TG_12982783_Lg8 genetic_marker RosBREEDSNP_SNP_TG_12982783_Lg8:25985..25985. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_AG_12983400_Lg8 genetic_marker RosBREEDSNP_SNP_AG_12983400_Lg8:26602..26602. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_TC_12984231_Lg8 genetic_marker RosBREEDSNP_SNP_TC_12984231_Lg8:27433..27433. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_AC_12985122_Lg8 genetic_marker RosBREEDSNP_SNP_AC_12985122_Lg8:28324..28324. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_CA_12985567_Lg8 genetic_marker RosBREEDSNP_SNP_CA_12985567_Lg8:28769..28769. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_GA_12985695_Lg8 genetic_marker RosBREEDSNP_SNP_GA_12985695_Lg8:28897..28897. Malus x domestica Whole Genome v1.0 Assembly & Annotation
chr8 chromosome chr8:11383428..11412538+ Malus x domestica Whole Genome v1.0 Assembly & Annotation
Sequences
The following sequences are available for this feature:

contig sequence

>MDC021050.213 ID=MDC021050.213|Name=MDC021050.213|organism=Malus x domestica|type=contig|length=29111bp
TACGGACATTTCACATGTTAAACTAATCTAGTTTTACATATAAAGGGCAW
ASATTATTGTTTGAGCCGTCTCATATAAATGTTATATGCTTAAACGATAA
AGTCCAAGGAATATGTGATTGGRAGAATGYAATCTAATGAAGTTAGATTC
ATGAGACCATTCTTTCGTAGACACATCCTAAATGTTCCTGATCATAGGAT
TGTCAATTGGGCATTGACAGTCCGTAAAGATCGGTACGTACTATGTCTTC
TCTCARGGAGAGTGATTAGTCTCGAGTCATTGGTGTGTGTGACATCAAGA
CAAGTACGTAGGTGCTCAATAGAGAATGAGTACACTGAACGTGATCAACG
AAGAGTTCTCATATTCCATGTCACATAAGAACTCATGGTTGGGATAATGC
AAAGTAGTCCTTTGACCTGAGGCATCACAGCTGTCTTGTGGTTAAGTCCT
TGATCTTTGATTATGTCAAAGTCACCCCCTCGRGGTGTCCACAGCATCGT
TGGGGTTAAGCCACTTAGCTATGGAGACAAGTGAATGCGCAACAAGGGAT
CTCTAACCTTCAAACAGTTGAGGGAGAATACTCTATGATATGATTTGGAA
TCTCTGGCCAGAGTATGAATGAGATTAGGGAATGCGTTCCAAATCACATT
CAAGGAAATCATATAAGCAAACGATTCACATTGGATAGTAGACATGAGTA
AATAAACTATCATACCAAACAATGTGGTCAAGAGTATTAGATTAGAGAAG
GACCGTATTGCATTTGTAATCCCGAACTGAATAGGTTCTCCACCTCTTCT
GATTAGCTTGGGTAACCATGATATGCTGCTAGGTGTCACTCATGGTTTGT
GGAAGCCYTAAACGTGTGTAATCACTAAAGGGAGAATTGAAAATAGTTTC
AATTCACAATCGATGTAAAATGGTTTTAATCGCCCACTACCTCGCTAAAA
GGAACCTAATGGATCGYACACCGTAAAAGGTAGAGATTGGAGATTAAACG
GAAATGAGTAAGAATGATTAAATGGTTTAATCATTTAATTATGGCAAGGA
TTAGTTAATATGTTAATTAATCAAACGAATAAGTTCGTTAAAGACTTCGG
GATAGTTTTGGACCTTAAGGCCCAATGGGCTTCGAACGTCAAGCCCATTA
AYTTAAATTGTATGACAATTTAATGAATAAAGATTCATTAAAGCCCAAAA
GCCCAAACATCCCTAAATGGCCGGCCATATTAGATGAATTAGGGTTTTGG
TTGTTTAGGTTACTTAAAGAAGTGACTATATAAATGACTTTATAGCCAAA
ATTCATTAAGGAAAAATTAAGGGTTTATTTTGGGGGAAAATTGGTGAGAA
TTGTCTCTCCATTTTCTCTCTAAAGAGGCCAACACCTTGGAGGGTACATC
TAGCAATCCTACTACTCCAAGGTCACTCATTTCTTCTACAATCAAACCTT
GGTGAAGAGACTTAGAGGTTCCCTATTTTGGGAACTTGGAGAAACCTATT
TTTCTATCCAAATCCATGGATCTAAGAAGCAAGGAATGAAGGCCCTATCT
CTTTGGGTGATTAGCCTTTGCTTATGCAAAGAGGAATCTACAAAGGTAAT
AATTTCAACTCACTTTGTTTTGAGTTGATTATTGGTTCACCAATCTACTA
GGCTTTKAATTTCATGGTAATGTTTTGTTTTTGAGTGCATGCAAGCATGA
TTCCGCCTTTAATTGTTAATTGCATGCTATATGATGTTGCTCAAATGAAC
ATGTTTTTAAAAATAATTCCTTCATATAACTCTTGTTAGGCATAAGTGTT
CCCCTAGTTGAGTTGTAAAGCTTGAGGGTTTTTTATTATGTGTGAATGCT
AGGAGTTCACATGTACAAGTTGTACCACTCGTCTTCTGGTTGGTGGAATG
AATGGTGAGTTACTTTCATCACTTGGTTGGTGGTACGAATATGAGTTCCT
TTATCACCTTTCATCACATTTCATCACCTGGTTGGTGGCACGAAGATGAG
TTCCTTCTTCACCTGGTTGGTGGCATGAGTAGGAAGTTGCCAAATGATAT
TAGAGTAAGGGTTGTATATTTCATCACCTGGTTGGTGGCATGAAGAAGRR
GTACGGGGTTGTACATTTCATCACCTGGCTAGTGGCACGAAGRWGAGGTC
ATTCTTCACCTGGTTGGTGGCATGAGTGGCAAGTTGCCAAATGATATTAG
AGTACGAGTTATACATTTCATCTCCTGGTTGGTGGCATGAATGAGAGTAC
GGGTTGTACATTTTATCACCTAGTTGGTGGTATGAAGATGAGTTCCTTCT
TCACCTGGTTGGTGACATGAGTGGCAAGTTGCCAAATGATATTAGAGTAC
GGTTGTACATTTATCACTTGGTTGGTGGCATGAATGAGAGTATGGGTTAT
ACATTTCATCACCTGGTTGGTGGCATGAAGATGAGTTCCTTCTTCACATT
TCATCACTTGGTTGGTGAGAATAAGGGCAAAGTGTCGAGGCACATTGTAG
CAAGTGTCGAATGACACAAAGTATGTTGAATCCTTTCGAAGCACAGTTGG
CTTATGTATGGATGTGTTGGAATGTATGATGTTTATGTATGAATGTGTTG
GAATGTATAATGTTTATGTTAATTGACATGAGTGATGCTTATGAATGTTT
TGCTATGCATGAAGGGATCCATGCTTTCGATATGTGAACCATGTTGGTTG
TAACACTTAGTATTACATACTTTGTGTCAAAGTACGCATGTTGAAGCTTT
GAGTTGGAGTATAGGGGTAGGTCAGCTTAGACCAAGTATTCCAGTGTTAG
GAATGCAAAAGACTCAAGAGAAGTTGTCTGAATTCCATCTTCTTTAAATA
TTTGCCGAATGGCTTGTGTGATAAAAGATCTCAAGCGGTTAAGGGTCAAA
ACATTTGTAATGTGTATACCTTCTTATAATAGCATTTCCTTTAATACCTA
GTCCTCTACTTTGAAAGAGTAAGGTTTGGCCCCATAGTCATAATAGTCGA
CGGTACGTTCACCCCTGGTTATCTTGATACGAACTTTTATCCCTCTTGTT
GTAATGAGCTTGCTGAGAGTAAAAATCATTCCTCTTATCAAGAGACAAAT
ACGTTTGGTGACTTAGAGAGTAGCTAAATGAGGCAGGAGATGATGCAATG
TGTGTCTGAATGGTCAAGATCTCCTCACTTGGTAGAACTTGACTTCCACT
TCCCACATGTTGATAGGGGTTAACCATATGGAGGTTCCCTTGTTATGTCA
TTGTTTCGTCGGATGCGTGGTTGTAAGCTTGTTGCCATCACCTCAAAGTA
AGTCCTCCAAGTGTTAGCATTGATCATGTATTGGAAGAAACAATCACGTA
GGCCTACCGTGAAGGCCTTGAGGGCGGTCTTGTTATATGCCTCAACGCAG
CGAGAATACTCATGGCTGAAGTGACTAACATACTCTCATAGTGACTCGTC
CAGCTTTTGGCTAATAGTGTACAAATCATTAGTTTAGAGCTCCACCAGAG
AGGGTGGAAGGGAAGAGAAGACATCATTCTTCGTCGGTGTGCATCTGATA
TGCCATGGTGGACTCAAAGAGGTTAAGGTGTTCAATCGGGTTATCCCTTT
TAGTATATAGTTGTAAACCAAGCTTTTGTTTTGTCTTTGCTTGAAGGGGG
TATCGAGGATCCTCATTGTAAGAGGGCCAGGCCTAAGTTGGTTCCAATAA
GGTATCTCAGCTTATCGTTCGGCCTTCAACTTGTTTACTTCCTTAAGGAG
TTGTAGGACAAGAGGGTATTGAGTGGAGTCATGTACCACTTGAGCTTTCT
TTCGTAAATCTCCATCTCCTCTTGGAAGTAGGAAGGTTTGATCAAGATCA
TGTGATTTTTCCCTAGACTCGCCATACTGACTTCCAAGGTACGTCTGTTA
GAACATCTCCGAGTCCCTATACCTTCGTGTTTCTCTAGGACTTGTTGCCC
CTTCCCCAAATTGGTAGCCGGCCTAGGACATGAATGGGGACCGAGTCTTT
CAGAGACCCTTGGGTCATTAATCTTCGAGCTTACATGGATGGGATTATCT
CGATGTTGCTTTAGGAAGTTTTGACAGTCACGAAAGACGGCTTTCAATCC
TTCTACTCCTTCTGTAAAGAGATGTCTTCCTCCACTCCTCCTGCTTCTGG
TCAAAGTAGCTGGGTTGAGAGAAGTCTCATGTTGGTCGCCATTTCGATGA
GTAGCTCGCTCCTCAACAGGAATACCCATGTCAAAGATAAATGGCCCTCC
ATGTTATGGGGCATCCAGTTGATGGTTGACTTCCACACGGGTAATAAGCT
CGAGTGTTTGAGTACATCTAATTTCGTGGAACGTCTCAAAAAGCTTCTCA
TATTGTTCTTGGAGGATCTCATTCTTTATTGCTATCTTATTGTTCTGAGC
CTCCAGCTCCTCGACTTTAGCTTGAAGAGCAAGCTTTTTTTTTTCCTTCT
TTCGTTGCTTCGCACTAGGTGTAAGAGGGGTATCATTCTGTGTGACGTGG
CTTCCTTCGCTCCCCATGTTGAAAATGGATGCCTTGTCAAAATAGAGTGT
ACRAATGGTGGAAACCAGCTTGACACAGCTGAAGAGAGTGGGAATAAGTG
TCTTTCTCACAGAAGGCGCCAAATGTTGATGTGCAAAATCAGTGAGGACT
TTGGTACAACATAAAGTGTTAGTTTGTGACCTTCGCTAGATTGCTCCGGT
CACTAGTGTGGATAAGTATGTAAATGGATAGGGATAGGGAAGAAAACACA
AGATGTACGTGGTTCACCAGATTGGCTACGTCCACGGAGTGGATGAGTTC
TCATTAATTGTTCAGGGTTTACACAAGTACATATGTTCCAGCTCTCCTTT
AATGAGTACTAGTGAATGATTTAGTACAAACGACATTCGAAAATATTGTG
GAAGAATGATCTCCTTTTATAGAAGATAGTTTCTAGTTTTGTTCTGACAT
TGACACGTGTCGTGTTGTGATTGACTTCTGATGTTAACACGTGTCGCGCT
ATRMTYAAYWWYCYATRTCKACACGTGTYRCKYWATKATTGGCCTCCTGG
TTGGAGGGAAACWCTTMTGGGTCATTTACGGTATAACGTTGACCGGTGCT
CGTTAGTTTGGGGATTGGTCAAGTAKRATACAAACAACAATAATGGTAAA
AAAGACAAAACTAGTGTTTATCAATCAAAATGTCAACTCCTATGTGGCAT
GACATGGAATGATAACAGAGTGAGTTACTGTCAAATTTGACAGCAGCTTC
AAAGTTATTTTTAATGGGTAATAAATACTTTTGATAATTTTTGTTATTAT
CTTTTGTTTTAAAAATACTAATTGCAATTATGAAAAGTAAATAATGCAAG
TAATAATAGTTTAAATTTGACATATCGAGTGGAGAACAAAATTTACAAAA
AAAATTTACAATAATTTCTGACCGCAAAATGTACGATGAACAAATGTGAT
TAAAGGATTCTCAAGATCCCCTAGTAGGAACCACCGTCCACTTGTCTGCC
CGTGTTATTTTTTTTAATTAAACCCATTCATTTACTAATCATGATTCTGT
TGTTGCTMTTACCCTTATTAAACTCAATAATCCATATSTACATTACTTAA
TTATGGCCCTAATTACATTTATTAATCATCAACAATACTTGTAGAGTTTG
ATTACTAAGGCCATCTCCAAAGAAGATGTCAAAACGTTCACATCAACAAT
AACGGTAAAAAAAAGACAACACTAGTGTTTATCAATCAAAATGTCAACTC
CTATGTGGCATGACATGGAATGATAGTAGAGGGAGTTAATGTCGAATTTG
ACAGCAGCTTCAAACATATTTTTAGTGGGTAATAAATGTTTTTTATAATT
TTTGTTATTATCTTTTGTTTTAAAAATACTAATGGCAATTATGAAAAGTA
AATAATACAAGTAATAATAGTTTAAATTTGACATATCAAATGGATAACAA
AATTTACAAAAGATCAATGTGCCACATAAGCCTTCAAATTTAAATTTTGA
TTTCAAGATTTAACATCTTGTTAGAGATGATCTAAAAACAAAGTCTTATC
TCCCTAATTGGGATCGTTGTATAAATCATAAAACGTTACTGCACTCGGTT
TTGCATCAAATTTAAATTTTGATTAGTATATAAAATTATTGTAATTACTT
GAATTTGCATATGTTATTCATCCACTCTGAACTTTAGTTGATGTTATAAC
AATGAGCAATTCATCTTTGGTGAATTCAGATGGTGCGTTACGGGTGTGTA
AAGGTGCAATGGGACAGGGTTCCCATTTTTTAGGGATTCCAAAATCTTTG
ATCCTCTTATATATTACATATGAGTATAAATTTTCTATTAATATTTTTTT
AATTGAAAAGAAAATTCATTATCATATTCTCATTGAAAATTATTTATTAT
TCATTGTGGATTACTTATGCCAAAAACATTTTTACTTATGAGCGCATTTG
YAGAGAGATGTTTTATAARAACAATATTGGAAATTTTACTAAAAATTGAA
TTGTTATATAAAATTAATTAAATGGTATATGCATTGTTGATTGGCCCAAT
ACATTTGAATGATAAATGATCTCTAATTGAAGAATAKGTGATTTTTAAAT
AAAAAATAAAAATTAAACGCTTCTAATTATAAAACTTGTATGATTAAAAT
ATGTTATTTGTAAATAAAAAATAAGYTCATCTYCAAAAAAGATGAAATTA
TTATCTTGTTTCTGTTCAAAACCTTCACATCAAAGATATTGATTTTTACA
GATAAACCCGTGAGGATAAAAGAATAGTCAAACACAAGTGGCACAAAAGC
TGGATAAATTATTTTCTAAAGTGGATAAGGACGAGCTTAAACACATGCCT
ACATCACAAATCTAATCACAACACCTGAAAAATCAGATGATATAATTGTT
TACTGACAAAGGTAGTGGATATAATCATACTTTACACATCTTTAATCATT
TTCTTAATMCATGGATGATAGAAGAGGGTCACCTCYGGATTAATWTGTGG
GTACGKTCAGTTTTTATCAGRTATTATTTATRTTTAATTTTAAATAAAAA
ATCAAATAATTTWTGTTCGTAKGATATACGATGAATGATTAAAAYGTGAA
AATYTTTARGATCTTCACAATTTGAATCCGAATAAAATTCAATTYTAGAG
ATGATATTCTTAATTATTAAAATATTTATAATGGACGCAAATTATTTATT
TTCTATATAAGAAGCTTGGAACTCAAGCTTGCACAAGCTAAAGCATCAAT
TAGATTTTATTCTTTTACAAAAAATCATATTTTTAAAAAATGAAATCATT
GATAAATAACAAACAGTCACAAAGTAAGGCCGGCAAAAGAAGCAACCTCA
AAGACAATCAGTAGCAAGTAAATTAACAATAAAATCAGGGGGTTCTTCAC
ACCAAAAGGAGGAGGTTCCATCCATACCGAGAGCAGAACTAKGGGGGTAG
GTGTTGAGAGTTGTCCCACATTAGTGATGGACAAARTTTGATATGTGCTT
ATATGATCTTGRGCTACTCTTTATATTACCAATTGATTTTATGATRGAAY
YCCAATTTCATCAGTAAGGAGCGAAGAACTAATGAAGCAATTACAGAAGC
TCAGAGACCAAGTAGCCACAAGGTCAGGGGGCTCAGTTGAACGGTTCCGT
AGGAGGTTGTTCCTAGTATCCCAAATACCCCATCATAATTTTTGTTACCC
CTCATAGAATCGCCAGAAAATTTGGCATGACCAAAAATGTTAACAATAAA
AGATTTCAACAACCGAAAATTAAATGGTAAAAAATTGCTATATAAAATAC
ACCAAAACATACTACAATCTCTCTTAATTTTCTTAGCAATACATACTATT
TAGCGAGTTACAATTTAGTCTTCCAACTCATTATTAGGTTGTGTAGTCTT
TTTACCCCTCATAGAATCACCAGAAAATTTGGCATGACCAAAAATGTTAA
CAGTAAAAGATTTCAACAACCGAAAATTAAACGGTAAAAAATCGCAATAT
AAAATACACCAAAAATACTACAWTCTCTCTTAATTTTCTTAGCAATACAT
ACTATTTAGCGAGTTACAATTTAGTCTTTTTAACTCATTATTAGGTTGTG
WAGTCTTTTTAYCCCTCATAGAATCACCAGAAAATTTGGCATGACCAAAA
ATGTTAACAGTAAAAGATTTCAACAACCGAAAATTAAAGGTAAAAAATCG
CAATATAAAATACACCAAAACATACTACAATCTCTCTTAATTTTCTTAGC
AATACATACTMTTTAGCGAGTTACAATTTAGTCTTCCAACTCATTATTAG
GTTGTGTAGTCTTTTTAACTCATTATTAGGTTGCGTAGTCTTTTTAACTT
GACGATCTCTCACACCGTCGATAAATGTCKTCCAATATGTTACGATTTAT
GTATAATTTGCAACACAAATAACACTATTTACACTTCAATACAGATTCAC
ATTGTTGGTCCGTCAGTTATTCCATCAAATTTGTTTAACAGTTCTTATTA
AGTTGGTTATACCGTCAAATTTGTTAACAGTTCATATTAAATTCGTTACG
GTTCACGGACCATTGCTTAGGGTATAAAATCCAAATTGATTAATGAATTT
ACATGCATTCATTAACACAAATATAAATCTCACATTAGAATAACTAAAAC
TTGGGTAATGTAAATTATGTAAWTTTTTTTTTCCTTAACATCACTTGAAC
CGAAGARGCTATGAAAATTTTCACCATACCAGACACAGTTAAACAARCTC
WTCAGCTCGGAGGATCGAACCGTATAATTGCATTCACCATACCAGACACA
GTTAAATAAACTCATCAACCCGGAAGATCGAACCGTATAATTATCCGAGA
AAACTTGAGATTTATTWARCGGAGAAAATACAAATATAATTATCCGAGAA
AATTTGACATAACAAGCGAAAAAAAAAAGGAAATTACAATTTCATAGACA
TTGATCAAATATCCAGCAGCCCCGACAAAATTCTTCTTCATTGTTTTTTT
ATCTGTACAAATTTGCAAAACGAAAKTTTAACTTTTTCACAGCTCCACGT
CGACTATTTACGTCAAAAAGCTTCAAAATTAACCGCGCTATTCACACCAA
AAGGTTCGAAGAATCAAAAGGCCACCGATTTTTACCGCACCAGCCCAGTA
ATAGGAATCAAAACGGAAAAACGACAAACGAGTCGACCCAGCAGACAGGG
GTTTCCACGRCTCSTCGTCTTCACGCACAYTCACTCGCTGACTAGATCCG
AAATCCAGCCCACGTCGGGAGCTGCCGTGCCCGAGTCAACTCGTCCCACT
CGACCAAGAGAGTTCTCCTTACTCAGCCTCGCGTACATTCTCGCCCGGAG
GTCCCTCCCGGACTCCACCCTCTCCATTGCCGGCTCCTCTTCGCACGGCT
GGTCCCAGAGATCAACCGGGTTTGGTCCGACCCGACCMGTTGTGCGAGTC
GGSGTCGAAGGAAGGCTGCAAAAACCGGGTCGGAACGCTGACCCACGTGG
TGAGGAGCCGAACCCGGATCCCATTTGGGTYCCCCATGCAGGCGGAGAGT
TCATTTTCATCTTAGCAAGCTTGAAGTTTCGCATCGAAGCAACAAGTTTG
CTCACCGAGTTACGGCCGAGWTGAGGGCTGTTCGGCGACATTGGCGGCGA
CTCAGACGGCGGAGACAATGGAGGTGACATCAGGATCGAGGTGGGGGACG
AACCAAATGGATACGAGTCCAAAGCTCCCGACCCTTGGGTTCTCGGGCTC
TGACCGGGCAGGACCCGGAGCTGTTCGGGTGTGTGGGCAAAGAAGCAGAC
CCGGCGGTTGCAGCGCAACCYGTCCTTGCATGGCTGGGTCCGGTACCGGG
CCGGGTGGAGCCAGCACTCGAAAACACCGTGAGCGAACTCGCACGAGTCA
CCCTTCGGGCAGTGGCCCTTGCGGAAGTCAGGGCATGCAGCGCCGGAGTA
GTGGTACTTTCTCGGGTCGCGACGCCGGGCCTTCTCGCCCGGGTGGGCGT
ATGGACAGTCGGTCCAATCGTGCGACCTGCCGTGCGCGCACCTCCGGACC
TTGAACTCGAACATCCGGAACTGATCGCAGGAGATCGGGTTCATTGGCAT
GTCCGGGTCCTCAGCCAGCGAGTCAGACTCATTAGACGGGAGGTAACGAT
GGAGAGCGGCGAGCGAGTCGAGGAACATTGGGGAGAGCGGGGAGTAGTCT
CCTCCGTTGGAGGCATTGCCGTTAGAGTTACCGGAGTGAATGGGGATGGA
GAAGGGTGAGGTGGGGGTATGAATAAAATGATCGTCAAGTGAGTCCCAGG
GAGGAACATGGAGAGTGGGGTGAAGTCGGGTCGGTTCTCCGAGCATCATT
TTCGGGTGGGGCTTTGAACCTTTCAGGCTTCGGAGCTTCTTCAGATGCGG
GAGTAGTTAGTCGCTGAATCGCTCTTATATATAACCGGTTTTTAGAGAGA
GAGAGAGAGAGTGAGTGAGAGGAGAGAGTGAGAGACGAGAGATTTTTAAA
TATGATCGGTACACGGACGGGATGATACATCACGTGTCATTAAATAAATA
RTGAAATATTTATGCTAGAAAGTTAATAACTTAAAATATAAAATTTCTCA
TCGTTACCATKTGTCACTAAACAAATAATGGGATATGTGTGCTAAAATGT
TAATAACTTWAAAAATAAAAAAYTTCATCATTTGTATTAAAACATACCAT
TTGTATTCTCGTCGTAACTAAAAATTTGTCGAGAGAGAGAGAGTGCGAGA
GGTTAAATAAGGAGGAKGATTCTCTACCCTCCTAATCTCTCTACCCATGC
CCTTCTATTTGAACGGTCACAATTAAACCACATCAACATCTTATATTAAT
TTTTTATTATAAAGATAATAAAATAAAAAATAATATACRAGAAGAAATGA
TGGAAAGGGATGCRAATAGGAGGATAAAGAATTCTCTTCGTTAAATAATG
CCAAGTAGGCCACATAGTCACATAGTGGGGATCGGATTTAACCGTGGTGG
AGTTAATAATGTAACCGCGATCAATTAACTCTTGTAAAATATCTGTGGAA
AGCCAATGGTTTAACCAAAAATAACTATTTTTTATAACTCCTCAACAATT
GGTGGGCATCTAAACAGATATTTATTTGGTCACTTGCCAAATTCGATAAA
GTTTCGATTCTCGTCGGATAATAATTTGGTACTTCGACTCATTCAACACA
AAGAAACCATTTTTTTCATATAAAAAGGAGAGGATATGTGGTACTATTTT
TTTACACATTTTTTAACATAGGTCKTAGTCAGTACMACAYTTTAGGTTTA
ACCAATGAAAACRAWTAAGATATTCATTTGCAGTGAAGACAATGAATRAA
TACARTTTTAYAAAGAAAYCCTAAAATCTTTAATCCAACGATCATATAGT
TTCAAATTTAGATGATTTTWGCTATACATGATGATTGATTRAGGGATGAC
GTAAAAGATATGTTGTTCAAATCRTTGAAATATATTACAAAATTATTTGT
GTAAAAATGTATAAAAAATTGTGTAAAAAAAATAGTATCAYTGATCCAGC
CCYTATAAAAAATAAAAGAAATATGTTTTTAATTGTTTAATTATCTAGTT
ATTGAGTGTGTTTTAATCTAAAAGCGTGCACAAATGGAGGATAAGCTTCA
TGATCAAACAAAGAGGAAGATAAGATGGAGCAAAGCTTTTGAGCAATGAA
ATCATGCAACATTCCAACCACTTGGATTATGACTGCATTCTATTAGTTCA
CTGCTACACAACTTATTCATAACAATTCTGTGGATTGTCCGATTGTGCAT
TAATTCATTCCCTTCAGCTACTTGGCTTTATAAAGACTCACGGATCACGA
CCCTGGTTTGAGTACAATTATCACCCCGGAGTTGAACCCACACGCAGATT
TCGTGATACAGGTAAGCAAAAATGTAATAATAATATTTAAGCACTTACTG
GTGAGTATGGTCTAGGGCTGCATTTAAATTTTAAATAAATAAAAATAAAW
AAAAATAAAAATAAAAAAACCAAATGAACCGTTTGAACTGCATCAGCGGC
TTGGTTTGGTTTTTTTAATTATTTTTTATATTTTTAATTTTTGGTGGTTA
AATTGAACTGMACTGCACCAATCTTAATCGATTTGGCAATTGGTTCCAAA
AAAAATTTAGGATGTTGTTCACCGAACCGACCCGCATATATTTAATTTAA
TTTTAATCATAATTAATAYGTGTAGTAATATAAATRGTTAGTTATTTACG
AATTRCCRTGTTTTCAYCATATGAAAACAAAACMTGATTAGTTTAAGACT
TATATTAGTGCTACATTTTATAGCTTTTGAGAGATAAATGTGTTATGTAT
TTTTGTTTTCACACAAACCGAGATCCAACCCGTCCTTGTCGGTTAACCGA
ACTGATCAGTTTTAGACCCAGCTTGATCAGTTTCGTTTGCAATTTTGATT
CAACTGACTAGATCGGTTTGGTTTCAATTTTGACCAAAAAACAACCCAAA
CCAACACTTGCTCACCCTTAATATGATCCAATTAAAATTACACATATTTC
TTATTTTTAAAAGTCCGAAAGAAGWTAAATAACATTGTACTATTTTCTAA
AACAACAAAATATTTATTTACTAAAATATTATTTGATCAAATTTAAAAAG
TGAGTATACAAAATACTCACCGGTGAGTCTCTTATTTTGACAATGGGCCA
CGTCTGGGTCAGTAYACACTTGTCCCGGTTCGTAAATACTCGGGGCAGGG
TTACGTGYAATTTGCAGACAACAAAATATGTACGGACGGCACGTGCGAGC
TCCTTCAGGTTAGCACACGTGGTTGGTGGCTTGGGTGTGTCTCGAGGTGG
CGGTGACCCACTTTTGTCCTCCCCCTGACAGCGGAGGCCTCCGATGGCTT
ACGCGCGGCAACGGAGGTGGCTCCCCGTTTGCTCTTCCTCGAGATTCTCA
TGATCTTGTCGAGTCAGTCGCCTTTTGAGGAGGAAAGAATTTTTACTATT
TACTTTTCCCTATATGTATATAATTAAAGGGGATTATATGAGAAATATAC
TGAGACACATCATATTAATTTAGCATTATCAACTTTCTTACTTATAATTG
CCTAAGGGCTGGTTTGGTATTGCTGTGCTTTGAAAAAAAGCTGCTGTGAG
AATAAGCGGTTGTGCTGCGAGAATAAGCGGCTGTGAAATAAATCAGCAGA
GTGTTTGGTAAACTTTTTTGTAAAAGTGCTTTTGGAAAAAAAGCAGTCTG
ATAGTGGGTCTTTTCATTAAATGAGCACTGTAGCTCCGTGTGCTTTGAAA
AAAAACCAGTTTTCCAAAGCTGCAAATAGCAGCTTCAGCTTTTTCCTTTG
ATTTCAGCTTATTCTCACAGCAGCTTCCAAAATAAGCCATTTTTTTCAGT
TTACCAAACACCTAAAACCCTCACAGCTTTTTTTCATGAGTGTTTTTTTT
TTAAGCWYCTYACTCCCAAWYCWYCCCTAAGTGAGTCTTCCAGATCTTCG
AAATGATAGATTATCGTGGAAAAAYAACAAGMTGGTCCTCTTRAAAGAAA
AATAAAATAAAATAAAATTCTTTACTAACAAATGTTGTCATAAAAAAAMT
TAAACACATCCATAATTAAGCCTTAAAAACGGAACTAATTTCCACCTACT
ACAAATCTAGCAATGATATTACATTTAAAATTCAAATTGTTACCCTAATA
TTTTTATTATTAAACTAACACATATCTTTCACATGCAAAAAAATTACTTA
CCACTRATATGGTATGGAAGAAAATAAAAATCACCATATGAAAACTTATA
GGTACGTAAATATGGATTTAGATTTCGTCTGTATCCTCACATCCTATTCG
TTTATCGTACATTATACAATCAAAAGTTATTTTAATTTTTTTATTTAAAT
TAAACACRAATAATACTTAACGAAAATTGATCGCACGATGTACAATGAAC
AAATAGAATATAAGGATTCCTAAGATCCTCATTCCGTAAATATAGGTACA
TACAAATTGAATCTCAGTTTTTTTTGCAATGCACACCAAAAAAGTTCAAT
AAYTGTAACGTAAAACGTAGGAAAATAAATTCCAATGACGAAAATCAAAT
ATTGAATCTTACACCCAGTTTTAATGAGAAGTAGATGTTTTCAAGAATAA
TAATTTAAGGATGTTATTTATACAACTATTTTTACTTTCACGCACTCTTG
TTAATTTATGTCATTTGATTTTTTTTTTCAATTCATTTGATCCGACTGCT
GTAAATTGAGAGGTGTGTGTCCACACACCCCTTATTTAATTACTCTTTTA
TTTATTGAGGGAGAAGCCATGGCATCACATTTKTTTCTACAATTTTTGCA
TACGTTTTTGTGAGCCAATYCGTCATTTATTTTAGCATTTCAAAATTGTC
TATCTTTTAAACAYCATTCATAGTTCAACCTTACAAAAACTTATACAAAT
CCAAACCATTAAGATATTCATTTTGTGGTGAAGGAAACGTACAAAGAAAC
CATAAACTTTTAATTCAATAGTCATGTGGTTTTATATTTGTGTAATTTCT
AGTAGACATAATTTTTTTWAAAAGACCTAAAAGATAGACGASTCGGATCG
TTAAATYTCWAACCGTTTATGCACTAATGTGTCAACAACCAAAATTTATT
CATGCAACTATAACATTTTCTTTTATAAATTATTATTAGCACTCTAAAAA
TMTATTTGTTGATTCCAAACTTACACTTTGAGATTARCTTTTAAAATTTT
AATAAAGATCGAATCACATGATCACAGTACCCACGCTTTCAAAGAATGTG
CAAAAAAGGCAAGCTCTTAGTGTTGGATATGATGCTTGCTAATTTAACTA
GGTGCATGACGGTGAATTAGTGGATAATCATTGAGTTCCATGCATTTGGT
TGCCCTAATTACTTTACTTAAGGAGTTAATTATGATTTAGTGGTGGTTTA
TAGGAAGATAAATCTCATCGGTCCGCATTTTAATCCYTCGTGCTTAGCGA
ATGTCTGGTGGATATGAAACATAAGATGAGATTAACTCACTTAATAAAGC
ATATTGGAGCATCACTYRAATAGAGAAGGATTAATTAAAAAACTAATCAA
GGGATTATCTTATGGGGTTGGGCCAACGGGTTTTTKAAATTGGGCTTAAC
TAGCTCAAAGAAACATTTGGGCTTCTGGGTTTTAAGTGGAGAGACATGCA
TGCAGTCCATATTTTCACGACAAGCCCAAATCAGAAGTAAATCCCACAAG
TTTGCCAAGAAAATGTCTGCACTGGGTCGGATTCAGAGCTTCTTGGGTAG
ARAAATGATTCAGTAACACCATCGAAACTTTCTCGGATGCGCGTAAAAAA
TGTACATTTAAGTTATACATTTGAACMGTCACTTAGTATTATAGTTTART
GATATTCATTTTTTTATAAGTAAGAGGTATCAGATTCGATTCTCTCTAAA
TTCTYACCAAAAGTGAATTTAGTGCACATTATTACTAGTTCATTGAGTAA
TATCGYTTGTTATATAAAAAAAAATTATACATTTGTACAAAAGTTATTAG
GTTATTCAAACYTGACGTGATTTAGTGTAAAGTAAATACGTCACTAAATT
CCAATTTTTTCATGAATTGAATTATGAATTGTAATATGAGACTCACAAAC
TTTTTCATTTCGTATAGTAATGCATGAAACATTAAAAATTGAAATAATTA
TGTCACTTAGTATTACGGTCTGGTGGTATTCCTTTTCGATTTTCRATTAG
AAGTGAAAGGTCWTAGGTTYGAATCTCGTGGATTGCGAATTCGATACTAA
ATTAGGCTRCCCATTGTTTGGCTTAGCCGAACTCCCCCTCCTTCTAATGT
AAAAATATTGATGTACTAAAAAAAATMAAAATAATTTCAATATTTGTTAC
AAATGAATTTAACATGTCATAMAAATATTGTAGACTTCAACRTAGGGCAA
CCCTAGGCCAATAAGGCTTCTTGSTTTGTGAGGRTCAACAAGAAACATTT
ATCAWAYGGAGCCTTACTCTTGTTTTGCAAAAATGCTATTTTCACAATTC
GAACCCGTGATCTATCAGTCACAAAAAACTTTTTCATTGYGCCAAGGATC
ACTTTCGTTGTATACTTCATCATGTTGCGACACAATTAACACACACACAC
ACACACAGTRAAAAAWTAAAAAAATTCCAWGTGTAATAATACAATTTTAG
TGTGTYGGGACTCCACTCGGTACAATTGGTTAAATACTTAAATAAAAAAW
ATATMTGTATTATAACACTTAGGGCGTGTTTACCAATCGRGAWTGRAATC
GAGAKAAACGGAATTKTACATTTCCCAATCCATTMTGACGTTTACTARCA
ATTAGGGAATCAGAGTTTTTRTGGGGACCACCCAATATCAGGAATTMAAT
TCCAGAATTRCCCGGAATTGGATTACCTCTATAGAGGTAGTATTTGAGTT
ACGGGTAGAACACTCCATTAGGAATCAAAATTTTGTACCCAAAATACCCA
TGTATACTCCTAAAACACCTCTACCATCATAAAAACCAAAACTTTTCATT
AGGCAAACCAAAACACCATATTTCTATCTTTCCCAAATAGCCAAACGATC
AAAGTTTCGKGYTGTTTAACACCCAACAAAAACAAGAAGAAGAAGAAGTG
TGTTCTCTCTCTCTCTCTTATGTGTGTGCAAAGCAGAATATGGAACAACG
ATGATGTAGAGATCATGTGGGTTCTAGAAAGCTGTTGGGAGACTTATTTT
AGTGTGAAAAAATGCATCAATATTTTCCAATGGTGSTAGCCAACCAATAT
TTTCCAAMGGGAATTGTTAATATTTTAATAAAACTATATAYAYACACAYR
YGTGTGTGTGTGGAATTGTATTAAAAAGTTATGAAATTTTCTATTATTTA
GATTAGGRTATTTTAGTAATCATATTAATTTTCATTTCGATTCAGSTGAA
TTGGTAAACAACTTATATGAATTTCGTTTTATTTTTACTCCAATTACARA
ACATTTAAGTAAACARCTTCAACARTAATCCRATTATGACTCCTCAATAA
TTCTYCMTCAATCMAATTCTTTTTKTTTTTTWATTAYGRTTACCTAATCG
CGCCTTAGTGTAAMGGACGGTGTTGCCGCACACTAAAAAATTTCTCCAAC
TGAAAGTCCAGTCGCACCTAATTAGCTGGCTAGGAGCCAATAGGCATTCA
GATAACTTACAATCAAAGACTAAATTATAGAAGAAGGAATCGTATTTCAA
ATTGTCTGGAGCGTCCATTCCAATTCAAGCATTCCAATCTGCAAGCCGAA
GATTAGATTTTTCTTAATTTTCTCGAGATTTCGCACAAGTCGATCCAACT
GTTGCCTTTAAGGATTGTCGATCGAACTGTTTTTGCCTGGATTAAAGTTA
AACCCAGACAAATTATAAAMAATAGAACATGGTCCCGCGCTTTTCGTAGG
CTTCACYTTTCCGCCGGCAAATTTTCAGTTTTTACAGTTGGATCGTGGGG
TTTATATATGAGGAATGAGGAGGCTCATACCTTGGCGCTTCAGAAGCGGA
GTCTCCGACGACAGCAATCATCAGAAGCAGAAGCATCCAAAGGTATGTTG
TCTTTTAGCTGTCGGAGGAAAATGCAGTTACCCATAAACTGTTTGTGTTT
GATTGATCGGAAATGGTGTTTAATTTGGTTTAGGGATCCAAAGAAACCAT
GGAGAAGAACCAACAGACCAACAACAGTGCCGCCGACAGTGTGGAGGTTC
GGTTTCTATTATTTTATTTTTCTCCTAGTTTACTTGGGATTTCACTTTCG
TCCATATGATTTATTTGGTCGCACTTTCGTCYTYGTAGTTTCATRTTGTT
TACACTTTAGTCCGTCTCAGGYTACAGTGTTGTTATACTATACTTGTACA
AGAAAACGTATTTTTTTTGCCTTTYTATTTGGATGGGGTTGCTCTTTGTT
AAGATTTAAGAAAGCTTGAATAGCAAATGACTTGTAGAGTAAAGGCTCGT
TTGGAAATACAAGCGTTTTTKGTGAAAATGTTTTTAGAACCAATTTTTAG
TAATTTGGAACCCAAAAATATTTCACTAAAGCGYTTTCAGTCATTTTAAG
AAAGCTTGAATACCAAACRAACCATAAGTGGATGGTAWGAATTGAYTGAA
AAAGTGGATGATAAGAGCGTTTATTCTTGTACGTGAAGAAAAAGTTTGTT
GGGTCTTCTTAGATGTTTGYTGGATGCATTCGGGCATGCCACCAATGGTT
GCCTATGAAGYGCAGAATTGCAAATATTGAYGAATATATTCACGCACAAA
CACACACTACSGMAATCTACSTCCACCCTATTGCATTGAAACCCCAAAAG
CGTTTTCATGCTAATTAAGTCTACAAATTTGCTATATGAGCATCTCACTG
AATTTTAGCACTTACGGAGGAAAATAATTGATCATGCTAGATTTTGAGAA
ACTAACAGCCATGCATTTGCACCAATATTATAATGACCTGTTCTTTCCCT
GGCAGTTTTCRAGCGAAAATGTTGCTGATTCAAGTAGTCACGGTCCAAAT
ATCGTACTGAACCATGATTTCTCTGGAGGGCTGCATTCTTGGCACCCCAA
TCACTGCAACGCCTTTGTTGTGGATTCAGCAGGAAGTTATGCAGTTGTTA
CGAATCGCCAACAATGCTGGCAGGGATTGGAGCAAGATATTACTGAAAGA
ATTTCCCCTGGATTTACCTATTCGGTTTCAGCGTGTGTGGGAGTTTCAGG
GCCTCTTCAGGGATCTGCTGAGGTCATGGCAACTTTGAAGCTGGAAAGCC
GAGGCTCAGCAACTGGCTATGTGAAAATCGGAAGGTAAATCATGTGTTTT
GTTAATGTTAGSGCATTTATTCTTTGTTTAWGGTAAAAGGTATTTGTTTT
AAAAGTAGTAACTGCCTGCAGAWGTWCTGTATCAAAKGGGARRTGGGRAA
RTTTGGATGGRAAGTTYTCWSTGTCGACAAWRCCTGATAGGGTKGTRTTT
TATTTGGAAGGGCCTYCKGYTGGAGTCGACCTTMWTATAAAATCAGTTWT
GATCTSTTSYTCTGAAKGCCAGGTACTTGTWTTTCTWGTCCTTTWTRTTG
CWMCATCWGAAGTACATATGKAATCACAGTTTTACACAGAAAAARATTGC
TTRTTYAAGGGTTGTAGTTMAGATTTCCRAAGYTAAGAAACAAGATATAY
AGMTKKWTTTMTTTWYTTCRAATGAGMWTTTWGGAGATGGMAGAASTGTA
AGAGATGRARMATTTSAWTTWWTYMTWATGAMTTCTTCCTTWWCTGTCAG
TYTGAGRACSAAAAMTTGGTGAATTCAAGTRGCAGAAATGSSACAAATRT
CATAKKGAACCATGRTTTCTCTGGAGGACTGCATWCTTGGCACCCGAGTA
ACTGMAATGGCWTWGYAGTTTCCGCCGATWCTGGWSASYSMARMGTAAAA
GCTGGCAAYYATGCTGTKGTTAMAAATYGGMARSAAWGTTGSYAAKGTTT
GGAGYAMGATATCACWCASAGAATTTCCCCAGGCTSMACATATTTAGTTT
CTGCRTGTGTTGGAGTCTSCGGRCCTCTTCAGGGMTCYACTGATGTCCTG
GCAACTTTGAAGCTGGAATACCGAGGTTCAGCGACMAACTATTTGCAAGT
TGGAAGGTAATGGTGCTTTTATTCTGTMAGGTGCATTTTTCTATTTCTTT
ATAGAAAAAGGAATCTGTTTTAACAGTAATAACTGCCTGCAGATGTACTG
TATCAAAGGGGAGGTGGGGAAATTTGGATGGGAAGTTCTCAGTGTCGACA
AAACCTGATAGGGTTGTATTTTATTTGGAAGGGCCTTCGGTTGGAGTCGA
CCTTATTATAAAATCAGTTTTGATCTGTTCCTCGAGCCCAAGTGAATGCC
AGGTACTTTTTTCTTGCTCCTTATATATGGAATCATAATAAACAATAGCA
ATTAAGTGTAACAGTAACTTGTTCAAGAAGTTTTTAGCCACAGGAATCTA
GTTTTATTCATTTATTTCTGATTGATTTTGGAATGTATATTTTGAAGAGT
GGAAGGACGGGGAATTTCAATGATGGAGAAGAGAATATAATCCTAAACCC
KAAATTTGAGGATGCCTTAAATAATTGGTCCGGAAGAGGTTGCAAAATTG
TTTTGCATGAYTCAATGGGAGATGGGAAAATCGTCCCTCAATCTGGAAAG
GTTTTTGCAGCTGCAACAGAACGCACACAGAGCTGGAATGGCATCCAGCA
GGACATCACTGGAAGAGTGCAGCGTAAACTAGCTTATGAGGCAACCACTG
TGGTTAAAATATTTGGCAACAATGTCACTACTGCTGATGTCCGGGCTACC
TTATGGGTGCAGTCACCAAATCAGCGTGAACAGTATATCGGCATTGCTAA
GTTATTATCTTTCTCCCCGTCTCTTTCCAATGAAATTGTGATTTATTTGT
TTCTTTGTTGCTAAGTTACTATCAGATGAGAAATCATTTCCCTTCCCATT
ATGTCGCCTTAATCTTAATGGATGTTGGTGTGCTRTAAAGTGTGCAGGCA
ACAGACAAGGATTGGACACAGTTGCAGGGGAAGTTCCTTTTAAACGGCTC
CCCGTCAAAAATAGTTGTTTATCTTGAAGGTCCACCGGCGGGAACAGATA
TTCTTGTCAATAGTTTTGTTGTCAAGCATGCTGAGAAAGCTCTTCCTTCA
CCTCCACCAGTCATTGAGGTTGGTTGAATGGATGATTCATTTTCTCTAAT
ACTTTCTGAGCATGTTTTCTTCGAGCTCAATTCGTAGACGCACACTAAAA
TATAGGCTTTTGTTTCTGTAGTTGCCAGCATTTGGAGTAAATATAATTGA
GAACAGCAATTTGAGTAATGGCACAAACGGGTGGTTTCCACTTGGTAATT
GTACTCTGAGTGTCCGAACTGGTTCACCACATGTTCTCCCTCCAATGGCA
ATAGAGAGCCTTGGACCTCATGAACCTTTAAGTGGTTGCTACATTCTAGT
AACCAAGCGCACGGAGACTTGGATGGGTCCTGCTCAGATGATTGGTGACA
AATTGAAACTCTTTTTGACATATCAAGTGTCTGCTTGGGTTCGGATTGGT
GCTGGAGCAACTGGTCCACAGAACGTCAACATTGCACTCGGCGTGGACAA
CCAGTGGGTAAACGGAGGGCAGGTTGAAGCAAGTGACACTAGATGGCATG
AAATCGGTGGTTCCTTTAGAATTGAGAAGCAGCCATCAAAAGTAATGGTT
TATATCCAAGGTCCAGCTGCAGGTGTAGACTTAATGGTTGCCGGACTTCA
GATATTCCCTGTCGACAGACCAGCGAGATTTAGACATCTGAAGAGGCAGA
CTGATAAGGTAAATGGTGTATTGTCTCATTTGTTTCAYAAGCATCATTCC
TCACCAAGCATTGCTTCAAWAAGAACCGAAAGTATAGACGATTCAAATGA
GAGCTAATTTGTTCTGAAGTCTTTCACTTTTATTGCAATGCAGATTCGTA
AGTGCGATATTGTCCTGAAATTTTCAGGRTCGGACTCGAGCAGCATGCTT
GGCAGCCTTGTGAAAGTTAAACAATCGCAAAACAGTTTTCCAATYGGGAC
ATGTATAAGTAGAACAAACACTGACAAYGAAGATTTCGTTGATTTCTTTG
TTAAAAACTTCAACTGGGCTGTGTTTGGAAATGAATTGAAGTGGTATTGG
ACTGAACCACAACAAGGAAACTTCAACTACAAGGATGCTGATGATATGGT
GGACTTGTGCAAGAATCACAACATAGAAWTGCGAGGCCACTGTATTTTCT
GGGAAGTCATCGACACAGTGCAGCAATGGATCCGTACATTGAGCCAGAGT
GACTTGTCAACAGCTGTTCAAAATCGACTAACAGATCTTCTCACACGCTA
CAAAGGGAAGTTCAGGCACTATGATGTCAACAATGAGATGCTGCATGGCT
CATTCTATCAGGAYAGACTGGGAAAAGATATCAGAGCCAACATGTTCAAG
ACYGCAAACCTGTTGGATCCATCTGCAACTCTGTTTGTGAATGATTATCA
CATCGAGGATGGTTGCGATACTAGATCATCACCGGAAAAATACATTGATC
AAATCCTTGATTTGCAGGAACAAGGTGCACCTGTTGGTGGCATTGGCATC
CAAGGACATATTGATAGTCCAGTGGGTCCAATTGTTTGTTCTGCTCTTGA
CAAATTAGGCATTCTCGGCCTTCCAATCTGGTTCACAGAGCTTGATGTAT
CATCCACTAATGAATATGTTAGAGCAGACGATTTGGAAGTGATTCTTCGC
GAAGCATTTGCCAATCCCGCAGTTGAAGGTGTAATGCTCTGGGGATTCTG
GGAGCTGTTTATGAGTCGGGAAAATTCGCATTTAGTGAATGCAGAAGGGG
ATATCAACGAAGCAGGGAAACGTTACTTGGCTCTCAAGGAAGAGTGGCTG
TCTGAAGCACACGGCCACATTGACGAGCAGGGAGAGTTCAGGTTYAGGGG
CTTCCCAGGAGCATACAGTGTTGAAATTGTTACTGCCTCAAAGAAGCCTG
TAAAAACATTCGTCGTCGACAAGGGCGAGTCCCCAGTGGAGGTCTCCATT
GCTCTCTAAAGTTGCTGCTCAACTCACTAAAGGSTCATTATTTTCGTTGT
TTTCGTATTTTATGCAATGTCAAATGACAATGTTGTGCCTGTTATGTAAA
GGGTTTGTAATTCTGAGTYAAAGAAATGATCTTGTGACTCTTCTGCTAGG
CCTTGAAACTTTTGATGYTGCCGGCCTTATCAGTTGGGCCAATGTTTTGG
TTGATGAAAAGCCTATTAAGCTCGTGAAGGTAATCATAAAGTGATTGAAG
TTCAATGGACAATTGCATGATGGAAGTGACAATTTTGGACAAGACAAGAC
AAGACAAGACTCGATAACACAACTTGRAAACCAAATCAAATACATGGATT
AGGGTTGGCAATAGTTATGTTTGGTTCATACGGTTGGCAATTATTGTGTT
TGGGTCATAATTCAAATTGTYTAATGCTGTTAATAATCTATTTGTAATTT
TATCTTTTRGGTCAACTTGCGTAACGCAAAAATGAGATACTTTTAACACG
TAGTGGCATAACCAACTAACCGGGTCAACCCTTTTAAGTTGAAGGTAAGA
TGAAAATTTTAACTCTTTTGTTTGATCAAAGGTTTACATTTTACGGATAA
TTTTCTACTTATGAATACTAAACGGGTAAATCCTGTTATTGTCGTGTAAC
ATTCTTAATAATCATGTCGTCTTCGTGTTTAATCCCATTCATGCTCGTGT
CAAAACGAATTTGACCCGTGAAAAAGGATTTTGCTACCTAAAATGTGATA
TGAAACCAAACTTTGTGTACATTTAGGRGRTGTAGTCAAACTCGGATGTA
ARAGGATTTTAGAATCTATTCAAATCTAKGTGTAGTCAATTAAAATATTT
TAAAGRATTTTAGAATCCATCCAAATCTAAGTGTATTAAAAAATTAAGAT
TTTGGAGGATTTCAATAAGTTGTGGATTTTGTGGGATTTGAGAGCAAAAA
ATATATATAACCAAAACTAAAAAGAATCCAACCTCATCCCCTAGGATTTC
AAATCCTTCAACCACAATCCACCACAATCCATTCAAATTCTTTAAAATCC
ATATAAATTTTATARGAGTCTTAAATTCTATTAAATCTATCACTTTTAAA
AATCCTTTAAAATCTTAGTTTGATTACACCCTCATTAATATCCGAAATCA
CTTGAGCTACAAGTTATTTAGCTAATATTGATAGTTATCCTTTTGCTCRC
ATATTTCAATACAGGAACTTTATTTTTGGGTACAAAATATATAGTAAAAG
TGTCGTTTCACTGGAATGAACTTCTCATTGGTTACTTCCAAATATATATA
TAGAGAKAGAGAGAGAGAGAATATGGAGCGTGAGATCAACATCAAACGGA
TCACATTAAACATACTAAATATGTAGAAAACAATTGAGAACTCCCTGACG
GGGGAGGAACATGGTTAAGCTCTGTATCCTACCAATCATTTGGGAGAGAC
TCAAATTACAATTTCTCCATRCGAAGGGCCCAAACCCTAAACATCTTTAT
CAAAGGAGTGTCCCACCGTGCCCATCACATCGACCTGATAGACTCCCACC
ATCGACTATTACTTCTAGTAGCCTAGTAGTCTAGTAGCTACTAGCTTTAT
GACTATGACTAGCGATATATATTCAAKGGAAATTAGTTGGGGAATYGCTC
CACGTTAAATTTTAACGATCCCTCTATTTTGTAAATTACGATTTATAAAT
TATTTTTGTGAGAATTGAATACAATTCAGAATTATTTACCTATTTAATTA
TTATGATAAAATTTTAATGTTTTTCCGAAACAAAATGTTCKTCAATTTCG
TTGAATTTAATTAGATATCTTAAATATTTTTTATTTAACTAATATTTTAC
AAATATGATTTATAAAGTGCAGCTTAAAAAATAAACGTTAAAGTTCGAAG
TGATATGAKTCACGCAACTCATCTCTATTTTTATAATAAAAAGAGATCCC
TTCCCTCCTCACACAACACAGAKCCAAAGGGAGGTGTGGAGGCCACTACA
CTTTGAACTTTAACGATCTGAACCGTCTATTTTGTAAGTCTCAATTCATA
GATCATCYTAACAAAAATTCAATTCAATCTGAAACTATTTGTCTATTTAA
TTATCAAGATAAAATTTCTTTRTTTCTTATATAACAATGTATTCGTTAAT
TTCTTTGAACCAAATTAGATGTCTTAAACATTTMTRATTTWGYTAATATT
TAWAACTTGAAAAATAGATTGTTTGGATCGTTAAAATTAGATATGGTGTG
GACCTCATAACAAATCCCYATTTTTATAAATAAAAAWATAAAAATTCCTT
CTCTTAAAAGTTTCCTACACCCATATATATATATATATATATATATATTT
ACATCTATATTTGTAGTTTTGAGTTKTTTATTATCTTCCCCTTTAGTTTG
ATTATCATGATAAACGGGACCCCAACAGTCTCATCCCTGTCTCTAACTAC
CTGGCTCCTGTGAACCCCACTTCCCACATGGGCTCATGGTAGCCATGCCG
TGGCGCACATTAGCCGGCCCTCTCACGCTCTGCYACATGGATTCATTGAA
TTCAGATACTTTCTGAATTTTTCTGTTTAGAACTAACGGATCAAAAAATT
TTGCCCGTCAACTATTTGGTTTTRYGTGAGATGAGTCGGTGAAATGAACT
AATAAAAATCGCAAGATAATTAAGTGATACGMATATATTCCTTGATCCGT
GGATTTAAGACATAGATCCYAAAAAAATCTGAGTTCACATGAAAAATAGA
GGTGACGTTTAGTGTTTAGGATTAGAATGTATAACTTTTTATATATTTGT
GCGTTAAAATAAGAAAAGAAAGAAACACASCTTTCATATTCTTTGAAGTT
GAAGGAACGAGAGTGATTAGTCATCAATAAAACTAATCTATTTCAATTAC
ACGATGGCAGAGTTATATATGAGGAATAAGTTTTTTCATAACTAATGCAC
TCTTATACTGTTAGTTTGGGGAAAACTTTGGACTCCATTGTTTATTTTAA
CGTACCTTGAAAGTAATTTGATAAAATTCAGTCTTATCGAACAAGACTTA
AATGAATGAAATCATCAACTACTSGGCACRTAACTCTTATATATTAATCC
TAGTGAGAATTATAACGAATCAACAATCAATTTACGTCACGCATGCATAA
ACAAGTGATGCTATCAAATCTCTTAGCACTATACCATTAGTAGGATTATT
TTGATTAATGTGTTTASTAATATWTAAGAAKYWAAAAATGTATTTAGRWT
TATTYTYSATTAACRTCWWTAATCTAATGYATRWRAARCWAMRAAATTAK
WTRSRTTWGCCAGTACTTAGCCTCATTTCATTGCTTTTTTTCCTCATATC
CCCTAACTTATGCAATCCATAATTTTTCTCACTCTAAGTAAACATTCATT
AATTTGAATTAAGGTCGTTTATAAATCTGCATACGCGTTTTGTAACAACT
TAAGTGTTGTTTTGATTATTTAATATCAAAATCAACGGAAACTGGTGACC
AACCATTTTCACGAAATAAAAACTAGGGAGTTTGAGATATGGGTGTCAGC
ATCAAAGGAGTTTACATTTGATATGATGGGGGTGTTGGGTGGGTCGCAGA
CGTATCAGAAAGTTTCAAAGAAAGTTGTGCTTATAAAATATAAATTAAAA
AAGAAAATTGATCAAAGAGATCGTAAAGAAAGAATGAATGGTGGAGTAAT
GGAGTGAGAGAGGAGAGAGGAATGGGGGGACTGGGCCGACTGGCAGCAGC
TGCAGGAGGAGAGAGTTATGGTGTCTTAAGCTAGTGCATTGGGAAACAGC
TCCCGCGCTGTTTTCGCGCGCCCTCTCCATATGACACCTCCTGTGGGACA
CCACGCATCCTCTCTGGAATTATCTCTTGTCTGTCATTAACCAACACCCC
TCCTCCCTCCTCCCCCACCCCACTCACAGTCAGTTTCTCAGATTTCTTCA
ACTTTACTATTATATTAACAAATATATATATATATATATATTACATTATA
CACATATATAAATTCTACTGAGTCTTTTTATTGTGTGTTAATCTGTTGTT
GTTGTGTTCAGTCTCTAATGACTGATGGGTCGTSTACTGGCACTGATATT
ATGTGAGGTGACCTAGACGGCCGGACCTTCCCTCCTAAGGGCCCTAACCC
TAGACATATTTKCKCTGGCCATACAATGACGTGAGAAAACAAAAATCCTC
CTACCCTTTGTACCTTCACTGTTGATCATGTTTTGTCTGCTCTTGCCTTG
CATGACACTTCKTTTTTAACCTTAAAAGAATTAATGGCAAATGATTAATT
AAACTTTAAAGGTAAAATTAATCGAAATTTTAGTTGAAGAGAGATCTGGT
CTTAGGTAAGATTATTTTTTCGCAAAATTATTTARTCATTCAAATATATT
AAAATAAATTATTAATGTATTTATTATGAATATGTTATTTGGTGTGTTRA
TATATAAGAAAACTAATTAAAAAATGYATGAAAATTTTGAGTTTTAACTA
TAAGGATAAAATAAAGGATAAAATGAATAGTAYCATGATTAACTTTTTAG
TGTAAAAATATAGTTTTTTGTTAAAGTGAACARTACCWGAAATTTTTCRT
TAAAATTTTCTTAATTTATTTCATACATTTRAATAACTAAATGATTTKTA
ATTCGAATAATTTTTTGTAAATATGATTTTATCATAATTGTACAATTTCG
ATTATGAAAGTAATACAGCGAATAWCTTATAACCCTTTACTTTATTAACT
AGGGTTTGCAATTATGAGTTCTTTAGTTATGCAGTAATGTACTGAATATA
ATTGATAACTAAAATAAAGGACCAGCACACCATTGCAGTTTCAGATATAA
CAGCGAACAAAGGAAACACAACCCAAGTGTTGCACATAGTTTCACCCAGC
ATCAAACAACACCATTTAAACACTCTTTATAGCTGATCGAAARAAAAAAA
ATCTCTTTATAGACCAATGGAAATGGTTCAGGAAATTAATATTAGGGTTT
GGTAGTTAACTTTCCACCGTCCATTGACTCCGTTGTCCACGAACCCAGAA
TATCATCATTTTTTTTAAGGAAAACTAATTAAAAARATTTWAAAATTTTG
AGTTTTTWWTYAAAATKACAAWAAGGTGTTGTAAGTAAATAGTATCAATA
GTGATTTTTTAGAGTAAAAATATCATTTTTGTTAAAAATAAACAGTACTA
AAAGTGTTTCGTTAAAACTCTTTTTACCATACAACGTGGCAGACCTGCAA
GAAGCTATAATAATCAGGAACAGATGGGTCACCATTGCTAGTAATTTAAT
TATTAACAAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNAAGAATAAAGTAATTGTGGTATAGGTAGCTCAAACAAGATCTTTCCT
TACATGAATTGATATGAACAACTTGTGTTTAAAATCAATTCTTAATTAAC
TATCCAACACAAGATTTAGAAAAGTTTGGGATTATGGATTTAAAATAAAG
AACAATTAATAAACATAGCTAGAATAACAAAACTAGAAAATGCAGCAATT
AGACAAACGATTTTGGAAAGACAAATGTAAAGAAAACGGTTTAGAAGTCA
CGATTAACAATCATACACAATTTACTAATTTCTTATGAATTATAACATAC
ATACTTTGAAAGTTAGGTTMTTCTAAGGCACATTCTCCTCATGATATTCA
AACTTGAACATATATCTAACATGCAAGAGTTATTAAGCTTTGTGAAAACC
TTTTGAAAAAACATGCAATCTTTAAKAGGGTGATGTTTGCCTTAAGTGAA
CTTACAATTATCAATCACAARAAGTCCTACTCAATTTTAGGGTGACGTTC
CAAMAAAAAATGTATTATATTACTTGTTTAAACATCTTAACAGTGTCCAA
TTAGTAAGACATATGAATAAGTTAAACATGATGATTAATAACTCAAAACG
AGTATGCATAATTTCATACGCAAATTGATAAGACACTGCATATTTATGTA
AAAGCTCCTGGCCTCGCCCCTTGCAAAAGGAAATTATTGATGCATATTCA
TAATTAAAAAGCAAAGTATCATTAGAAGCAAAGATAGACCTTGTAGGCTC
CTAAAGCCAAGTTCTAATCCCCAAAAACGTTCTAGCCTTTTAGGGTTTCT
AACTCAGCATAGACTAACAAATTTGAATCCTACCTTAAAATAGGCGTCCC
AACAATTTGGAAAAAACTAAATAAAATAATAAAACTGTGAAAGACAATCC
TATTCAAATAGGATAATCTGGTCAACCGCAAAGTCAACTCATTTTTTACC
AAATCTGCCAA
back to top