MDC022293.67, MDC022293.67 (contig) Malus x domestica

Contig Overview
NameMDC022293.67
Unique NameMDC022293.67
Typecontig
OrganismMalus x domestica (Apple)
Sequence length12723
Analyses
This contig is derived from or has results from the following analyses
Analysis NameDate Performed
Malus x domestica Whole Genome v1.0 Assembly & Annotation2012-07-26
Alignments
Feature NameTypeLocationAnalysis
MDP0000312449 mRNA MDP0000312449:3963..5362+ Malus x domestica Whole Genome v1.0 Assembly & Annotation
MDP0000312449_exon_1 CDS MDP0000312449_exon_1:3963..4097+ Malus x domestica Whole Genome v1.0 Assembly & Annotation
MDP0000312449_exon_2 CDS MDP0000312449_exon_2:4724..4820+ Malus x domestica Whole Genome v1.0 Assembly & Annotation
MDP0000312449_exon_3 CDS MDP0000312449_exon_3:4873..4949+ Malus x domestica Whole Genome v1.0 Assembly & Annotation
MDP0000312449_exon_4 CDS MDP0000312449_exon_4:5045..5362+ Malus x domestica Whole Genome v1.0 Assembly & Annotation
MDP0000312450 mRNA MDP0000312450:5706..11882- Malus x domestica Whole Genome v1.0 Assembly & Annotation
MDP0000312450_exon_1 CDS MDP0000312450_exon_1:11079..11882- Malus x domestica Whole Genome v1.0 Assembly & Annotation
MDP0000312450_exon_2 CDS MDP0000312450_exon_2:10100..10638- Malus x domestica Whole Genome v1.0 Assembly & Annotation
MDP0000312450_exon_3 CDS MDP0000312450_exon_3:8870..9726- Malus x domestica Whole Genome v1.0 Assembly & Annotation
MDP0000312450_exon_4 CDS MDP0000312450_exon_4:8338..8410- Malus x domestica Whole Genome v1.0 Assembly & Annotation
MDP0000312450_exon_5 CDS MDP0000312450_exon_5:8171..8225- Malus x domestica Whole Genome v1.0 Assembly & Annotation
MDP0000312450_exon_6 CDS MDP0000312450_exon_6:6946..7905- Malus x domestica Whole Genome v1.0 Assembly & Annotation
MDP0000312450_exon_7 CDS MDP0000312450_exon_7:5850..6314- Malus x domestica Whole Genome v1.0 Assembly & Annotation
MDP0000312450_exon_8 CDS MDP0000312450_exon_8:5706..5789- Malus x domestica Whole Genome v1.0 Assembly & Annotation
MDP0000745534 mRNA MDP0000745534:262..878- Malus x domestica Whole Genome v1.0 Assembly & Annotation
MDP0000745534_exon_1 CDS MDP0000745534_exon_1:262..347- Malus x domestica Whole Genome v1.0 Assembly & Annotation
MDP0000745534_exon_2 CDS MDP0000745534_exon_2:440..519- Malus x domestica Whole Genome v1.0 Assembly & Annotation
MDP0000745534_exon_3 CDS MDP0000745534_exon_3:787..878- Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_TC_13739176_Lg8_RosCOS256_MAF30_MDP0000312450_exon2 genetic_marker RosBREEDSNP_SNP_TC_13739176_Lg8_RosCOS256_MAF30_MDP0000312450_exon2:10198..10198. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_GA_13741742_Lg8_RosCOS256_MAF30_70071_exon1 genetic_marker RosBREEDSNP_SNP_GA_13741742_Lg8_RosCOS256_MAF30_70071_exon1:7633..7633. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_AG_13736735_Lg8 genetic_marker RosBREEDSNP_SNP_AG_13736735_Lg8:12643..12643. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_GT_13737584_Lg8 genetic_marker RosBREEDSNP_SNP_GT_13737584_Lg8:11795..11795. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_AG_13737598_Lg8 genetic_marker RosBREEDSNP_SNP_AG_13737598_Lg8:11781..11781. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_TC_13739176_Lg8 genetic_marker RosBREEDSNP_SNP_TC_13739176_Lg8:10198..10198. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_TC_13739398_Lg8 genetic_marker RosBREEDSNP_SNP_TC_13739398_Lg8:9976..9976. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_GT_13739750_Lg8 genetic_marker RosBREEDSNP_SNP_GT_13739750_Lg8:9624..9624. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_CT_13741605_Lg8 genetic_marker RosBREEDSNP_SNP_CT_13741605_Lg8:7770..7770. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_CT_13741613_Lg8 genetic_marker RosBREEDSNP_SNP_CT_13741613_Lg8:7762..7762. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_CT_13741622_Lg8 genetic_marker RosBREEDSNP_SNP_CT_13741622_Lg8:7753..7753. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_CT_13741632_Lg8 genetic_marker RosBREEDSNP_SNP_CT_13741632_Lg8:7743..7743. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_CT_13741633_Lg8 genetic_marker RosBREEDSNP_SNP_CT_13741633_Lg8:7742..7742. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_CT_13741649_Lg8 genetic_marker RosBREEDSNP_SNP_CT_13741649_Lg8:7726..7726. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_CT_13741669_Lg8 genetic_marker RosBREEDSNP_SNP_CT_13741669_Lg8:7706..7706. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_TC_13741670_Lg8 genetic_marker RosBREEDSNP_SNP_TC_13741670_Lg8:7705..7705. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_CT_13741688_Lg8 genetic_marker RosBREEDSNP_SNP_CT_13741688_Lg8:7687..7687. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_GA_13741742_Lg8 genetic_marker RosBREEDSNP_SNP_GA_13741742_Lg8:7633..7633. Malus x domestica Whole Genome v1.0 Assembly & Annotation
chr8 chromosome chr8:11766479..11779201- Malus x domestica Whole Genome v1.0 Assembly & Annotation
Sequences
The following sequences are available for this feature:

contig sequence

>MDC022293.67 ID=MDC022293.67|Name=MDC022293.67|organism=Malus x domestica|type=contig|length=12723bp
GTTTTTAATGACATGTAAGCTCTTTAACATGCACTCGTTAACTGCTGATC
CTATCTATCTTGTGGATATTTAGTACCTTTACTCCATTTAACTCACTCCC
AAAAATAGAAAATAAAGGAGCTTCATGATCAGTGAACGGAAAATCGTCCT
TTGAATGCGTATTTCCTACCATCTAACTCCATAAAATGGGGGTAAGGCTA
GCCGACATTCACCTCTCCCAGACCCTGCGTAAAGCGGGAGCCTTGTGCAC
TGGGTACGACCTTAACATCTCCAAATGTCACTTATTTTCGAAAGAGAAAA
TCRAGGGTCCAAATCCAAGAACTTCCWGTCTTTCCATTGGTTTCCTTCTT
CATTAACAAACCAAACAATTTCCACTTTTTAACTTACTCAAGTAATGRAM
TTTTTACAAATTAAAAAGAAAAGAAGAGTAGGAGCTCACCTCCATTGGGA
CCAAGAGAGTGCTCCACCATCACATCACTCAGTTTTATAAGCTCCTCCAT
GTTCACAGCACATTCATACCTAAATTCACGTAAAGGCTCAACATTCTACA
TTGGAATGCAATGCAACACTACAAATTACGAACAACAAACACGAAAAATA
AAAATAAAAAAACCCCGAAAAGGATACGGCAATGCATCGTTGGCAGGATC
CAAATTTACCACAGCAACTTTCCTGCACACCCAAACAACAAACTGCCACT
GTAAATATCTCAGACAGATTCAAAAAMCAAAACTGAAGCCATGGAAAAAC
TTGAAAMCCCCGAAATCAGAGTGAAATTTTTTTCACCTTCCGATGAGCTG
GAGGAACTGAGACATGCCATTGCAGTAAGTCGTCTTCCCTGACCCAGGCG
GGCCGATCACCACTTGCCCAAAAAYCATCTTTGGGTTTTAGGGTAAAGTC
GCCGGAAAATCGAGAGAAGTGATTGTTCAGGGCAATGCAATCGAAGAATT
GAGAGGTTTAGGGTTTTAAATTTGGGGGCGGTAACTGAGGGAGTCGGCGG
CAAAAARCAAAAGGGARTAGAAATTAATAAAAGTGAAAAAAAAAGGGGGC
ATTCCGAGAATCGAACTCGGGACCTCTCGCACCCAAAGCGAGAATCATAC
CACTAGACCAAATGCCCTGTTTGTTTGTTATCTATGGCCAGGTATATTTA
ACCATACAATATTATTTAAATTAAGCCCCTGCATTATCCGGGCCCATTGT
TATCCCTCTCCTTTGGACTTTTGGGCCCATTTMATWYAATTTKKAYRARM
WTMWWGTMATYTCAYTWTYATWYWMATGKSATGRRSYYCWAYYAMRRAMT
RRAAASTMRMWAKGTTKCARTWAAWAARGGTTATTGWTAKCWASRRAMCG
YATCYAAKRTGTCCCTATTTATAATATCGATGCACGTAGAACATTATTAA
TAGAGAATTTTTKACATCTTATGATTTTTTTAGARATTTTTCAATGTGCC
AGAAACATGMATATTGGYTGAAAACTTGAAGAAAAAAAAATCAACCAATT
AAACTATAACATTTGATATATCAAACCATATTTTCAGCTCATTGCAAAAT
TTCATTAAATAGATGTTTGAACTAAAAGATGGAAATCCCACATATGGGTA
AATTATAGCTTTCAATAGGCAAAAGCAAAAGTCCAATGTGGGACTYCCAC
ATATTGCACGGATGGAATTTGGAATAAGATTTGTCATCATGATCGAGTGT
GGTAAAAGATTAAAAGAAAGAGAGTAAAWGACTAGTTTTGTGMCTCCATC
ATTTAAAACTCACGTGCAATGTTTGGAACCTACGCTAAGTCACGTTTTCC
TTCTGCATAGCTAAATTTGAAACCCTAATTTAAAATAGATTATAATATCG
CTCGAATAAAAAAAAATTTCAGATGATCAAACAACTCTAACCATCTGCTA
TATCACAACTCTGCAAAAAAAACGTATGTCATTAGGTCCAAAATGTCCAA
CTGATATATCATAGAACATTGKTTAGGAATAAGATTACACGGAGATGYTC
TTTTAACAAAACGGTTTGTTATAATTATGTTGATAGATTGTCAATMGAAA
TGATCGGTTAAGTATGTTTGAAACAATTTCACTCAAATATTTAACTTTAA
TTTAGAGGCCATCTCCATCTTTATAAAAACAAAAMAAAAMAMAAAAAAAA
AAGGCTTTTTAACCAAAATGGTCTATGAGATTGGCATAACTATTCACTTT
GATATTGAGATTTAAAATTAATATAAGTGATCCATGAGATTGTCCACCAT
CAATCATTTGGGTTATTCAGTGAAAAATCTCTATTAAATAAGACTAAAAT
GACAAATATACTCTTGAATTTTGTCAAATCATTTTGGACAATTGTTTATT
GAAATGAATTTATTTTTGTCATTCTTTAACAGAAATTTTCACATAATGAC
AAAAATAATTGATGGTGGACAAACTCAATCATGACTTCTATCAATTTCAA
ATCTAAAGAACCACAATGAAGAATTATGTCAATTTCAAATACCATTTTTG
GCTAAAATGCTCAAAAAGAATGCAATCATGGAGTAAAATGTCTTTGAGAA
TATAAACATGCAATGCAATCCAGCTAGGCAATGAGATGATGAAGTAGTGC
TGGCATTTGATGGCATGGACCATCAAACTTTGTGAAAAGTCACTAATTTG
ATGCTTCAAGTTCAATTTTGAAAAAAGGGGTTTTTAGGTGTTACCCATTC
CATTCATACATGTTTCCCACTCATTAGTGTCCCACAACTCTAATTTAGCT
TCCAACTAAAACAAATCAAATTACTAGTAGTCATTTTCTGAACTAATTAA
ACCTCTTTATACACCCCCAACCGCAACTAAGCAAGGACTTGAAAGTACTT
TTAAAATGAATGAAATTACTTTTGGTGAAATTGATTTTAGGTTCCAAAAA
CGGAAGAATCATCAGATGTGTGCTTCTTGCATGAAACATTTAAAATATTT
TTTCAATATCCACTTGGATTTTTACTAAAGATTAATTTAAAAAACATTTT
CATCAAAAGCGCTTTCAATCATTTTAAAAACATTTTCAGCCACTCCTAAT
ATATTGCTAGCAATATTGGAAATGGAGATTTGAACACACAACTTTTAGTA
TTAGGTAACTGTTTTTAACTTTTTAACCACTTGAATATTGACCTGACCAT
CTATTTGAGCTATAAATTCTTTCCGATCAAGGCCGTCCATCCATATTGGC
CTGGCCATCTATTAAATGGAGGTGGATTGTCTGATCTTTCTCATTTTCAT
ACTTTTTTTTATTCATTTCTGTTTTATGTGGTCATGGTTAAGACATGTCA
ATATTTTATATTCTTATTACTTTTTGTTTTATTATTTTTATACAAAAATC
AATATAAAATATTAACATGACTTAACCGTAATCATACAAACAGGAAGGGA
TGAGAAGAGTATGGATAAGATGGCAGACAATCCACCTCCCTATTAAATTT
GCAATGAAGTCAGCAATTTGTTTTTACATATTCCCATGTGTCGTGAATAT
TTCCAGCTGACATCGCCATCTCATAATAATGCAGAAAATCATTAGAAAAA
AACAAATCAAATGTATGGTTTTTCAACTAGAGGATAGAAAAAAAAATTAA
TGTGCTGAAAAAACGGTCTGATACATTAAGTAATAATATAATTGATTAAC
AAATTTAAATAAAAAATAACTAATAACATTATAATACTTAATGAACCGAG
TTATGTTTTCAGCAAAAAAACAAAATATCTAGAGAGCGAGAGACAGTGGT
GGGTAGGTGCTTGGAAATGGGACAACATGATTGCTAATTGCAGCAGGTAA
CCTTAATCATATTCATCACAACAGTTTGACAGTTGTGCTTCTCTTTTGGT
CTCTGCATTCTCATTCCCCCCTCCAACCCCAATAATCTCTCTCATTCCAT
TTCTCATATCTCCCCTTCTTAGAGAGAGAAAGAGGAGAGAGAGAGAGAGA
GAAGAAGAAGAAATGGCATTTGCAGGAACAACTCAGAAGTGCATGGCTTG
TGACAAGACAGTGTATCTGGTGGACAAGCTCACAGCTGACAACCGAGTCT
ACCACAAAGCCTGTTTTCGGTGCCACCACTGCAGGGGAACCCTCAAGGTT
CGTTAACTTACGCTGCTCTATAACTAAAAACGAAATGGTTGTCAAACGAC
TCTTAAAGTCTACATTTTCTCATTTCTGGGACGGATTGTTGAATTGAAGC
AAAATCTAGCAAAACCAGTCTCATATTGCTGCACTAACAAACCAATTAAT
GCGATAATTAAGCGTTGTTTTCGGCATACTTTTCGATCTGTTAGATGTTC
TTTCTTGTTTAGAGTAAGCTCATGCTTTATGGTGCTTAATGCTTACCATG
GACAAGTTTTTTTGAACATTGAAATTCCAGAAATTTCACTTTTCACCTGC
ATCTTGATGTTATAAGATCATAGATTAAAACCGAAATGGATATGTGGGTT
GTTCAAATGCAAGAACAAAACTAGAGTCGGCAGATTGGCAAACTTATAAT
GTATAACACCAAAGAGTGAACCATTAGTCAGAAATCGGATTCCGGTCATT
CCCTTCTACCATTAATTCTGGCATTGTTTTACCCCGGTATCATTCTATAT
CGACTTGGATTTGATATTCATCTGTAAATCGATAAAGAATGATTCCGGGA
TAGAAGATCAAATAACAACTTTCCATTTTTGGTTTTCATATACAACTCCA
TTGACCGATTGATGAATTTGCAGCTCAGCAACTACAATTCCTTTGAGGGA
GTGCTCTACTGCAGGCCACATTTTGATCAGCTCTTCAAAAGAACCGGCAG
TCTTGACAAAAGTTTTGAAGGTAAAATTAAAATCCCGCTTCAATAACTTA
CCTTCCCTTCTCATCGCTCAAGTTGATCAACTTCCGTTTCGATCTCCTTT
CTCAGGGACACCAAAAATTGTAAAACCAGAGAAACCTATTGATAATGAGG
TATRTATTTGTCYGAAARTCTTTAAAAGCTTGCCTATGGATTCTACAAGT
CTTTGACATCTGCTSATCGTCGCGATKACAAATTTTTGTAACAGAAACCT
GCAGTTGCGAAAGCTTCAAGCATGTTTGGTGGAACMAGAGATAAGTGCTT
TGGCTGCAAGAATACTGTCTATCCAACAGAAAAGGTATCGGTMAACGGAA
CTCCTTACCACAAGATGTGTTTCAAATGCACACAYGGAGGGTGTACRATC
AGCCCATCGAACTACATTGCGCACGAGGGCCGGCTCTACTGCAAACACCA
CCACACCCAACTCATCAAGGAGAAAGGAAACTTGAGCCAGCTTGAGGGTG
ACCATGAGAGGATCGCGGAGGATGAGAATGTCGGYGCCAGAGAAGTTGCT
RCCGAAATATGACWMAAAGAAGACGGTCGCCTTAACATCCGTTCACTATG
CCTGAGTGGTGTTGCTGTCCCTCATACCTTATCATTTTCCTGCAAGACAG
ATGAGTCTAAGTATAATTGAAGCGTGTGGGTTCATTCGTTTGTTGTTTTT
GGTTTCCCTGTGAGGTTTGTGAATGATCGAATGAGATACCAAATCCTATA
TTTTCAATCTAAACCCTAATGTTTTGTTGCTTTGAAATTTTGAATAAAGG
AGGAGGATTCCCATGTTTTGAAAGCAATAAAACATGCAGACGTGAACCGA
TGCGCTTCTCYGAMGCACTAGAGTTCRAATCTCCGTCCCCACATCTTAAA
TTAGTTTAAAGTAAAATRTTGCTTGTATCAAAAGAGAACAACAAAACAGG
AAGAAATTCAGTCATCGGAATTATGACTGCAATGAAATTCTGTACAAAAA
CAAAATWAAAAAYGAAGWAGGAGAGCATTCGTCACGACAARGKYTCCACG
GTATCAAGMAGAYGACCRTTCTTGGCAACATGCTTCAAGTCTCTGATAAA
ACAATCTTGAAGWGATCCAAACCCGAATGTTCCATCCCCATATTGCCAAA
TCCTTCCATGTGCAAGGAGAGGGTTAGGTCGGGGCCAGTTCGGAAGAGCT
AGATCATGACTTAAGTTTATGCGCAGAATGCGGGARACTATTTCATTTCC
CGCAAGAGGGAGATGCTGGTGAGCGTGATCCGCTGCTGCATTTGGTCGAA
GATGTATGCGACTAGTATAYAAATTTTCTTCCTCTGGGGAAATCGGAGAC
TCGATAAAAGTAGGGTTCACYGTCCAAAACACTGGTTGCTTACTGATAAA
ACGCATTAAACGGCAGAAATTCTCGGACTGGTCGCAAATCCTTAGGCAGG
AAATGCCCCCAATGTCATCATATGCAACAAGGTAAAAACCCAAGATCATG
TCATCATAAATTCCCTGCAGTGAGGAAGAAGATGAGAGGGTTAWTTGTGC
CATAATTGAGACCTCTTCTGAATCCACAATCTTGTAAYGGCACATTATAA
GCAAAGAGCGAAAAGYGCAAAAACCRRTCAGTTAWAACTAGAGCTGCCTC
ATCATACACAAARTTTGGCTGATTATGCACCTAAAGCAMACTGATCCGAC
TTTCCTAAGGCAGCAACKAGACTTCTTAAMCCGTGTTTTTTGGTTATACA
CAGTAGTATCGRATTCTACTCAAATAAATCAAYGAAGCTAGAAGCTTAAG
CATCGACTATAAGATTCAAGCACTTGTAAACTAACTGATTGATGCAGAGT
CGCAGACAGATCTYCGCTTGTAAATTTCACACCWAACAAACTGATGGGTC
ATGCTTATATAATCTAAGAACACTATAACCAACTTGATCAACCATCAGTG
TRCACCTTAACGATTCGGAATAAATTCAGGTGCCAATTCTAAACTCCAAA
TTACAAACTAGACACATAGCRAAACCGAAAGCAAAATGTTAATGCGTGTG
TGTATATACTRAGGGCACAAAATCYCTCGAGGCAATAACAATCTTCTATT
CAAACTTTCAGCTGAAAAATACAAGTACAAAGASAGAAAAGGCACCTTCC
AGAGGCCCTGCAAAGGCCGAGCCGCCGTCGGCGAGCAATCGACAATCTTG
ACGAAATGTTGAGGCTCCAGCTTCCTCCTTGCCTGCCTTTCCTTCTCTCT
CCTCCTCTGCCTCCTRGAAGCTCTATCCGCACCCGGGCTGGTCCGGTTCG
CAAAGTACTGATAAATCTCCACCACCGCCTGGTCCGGCGAGGTCCCCGGA
GAGCCACTACTCTCGGCGGCTCCAATCAAATCCTCGCCAACCCCGCTGTT
GTTTCCGCGGCCACTCCCCGAGCTCGAACTTCCCCGAGCCCCAAAGCTTG
CATCTTCCTCSACAACAAAATAGGTCTTCCCCATCACGCTCAAATTCACA
GGAACCAAGTCGCTCTCCCAAAACTTGAACCGGTCGGAATCCGCGAAATC
TTCCGAAATCTCGGCCCGGCCTTCCGGGTCGAGAAAGTTCACGACTTGCC
CCTCCGGCGAGAGGCTCATCCACAAAAACGGCGCCTTTACGACGCCATAA
GTGCCGTCCTTGGCCGGAGAGATCCGGAATCCGGTCACGAACGACGGGCC
CCACTCGAATAAAATCAACGGTGACGATATCGCGACSCCGCCTTGGCGCC
AGAACCCAATCAGATTCTCCCAATCGCTGAGGGTCTGGTAGAGATTCCTG
TACGTGATTTTCCCATTTCCCCACTTCCTGATCTGGGTCTTGGATCCCCA
CCTGCGGTCGCACATGTTGAACCAGAGCTTGCAGTCGGATTTGCAGAGCG
AAACAGACCCTTTCGATGTGCAGGCGAAGCTGGCGACCTCGGGAGGCGTG
AGGAACGAGAGGATGCAGAGCTGGACGTCCTCGGGGAAATCGGAGAAGGA
AATGGCGCGACCCGATTCGTCAATTGCGAGACTYGGGTCTCTGATTGTCG
YCATTTCGGATTCGGGAACTTTGGCGATGAATTTCTCGGGAAAGTTGTTA
ATTTTCTGGGGAAAATTGGTGGCAAAATACAGACGTTGGACAAGGAAACG
AGAAAGTGTTGTGTTGGATGGGATTTGGGAGATTCTTCGGCGAAAGSGAA
TGATTCTCTTTCTTCAACCTTGCTGGAGCACAGGAGTCTCGAAGACTTCC
ACGTTTCTGTGCAAGTAAATTGACGGCGTTTGTTAGGGTACAATTGTAAC
GTAGCACTCGTGACACGTGGTGYACTCTTSAAACGTGGAGGCCCGAAGGC
CCAAGCTGCCARATACTCACCCTAGGCCCAACAAGTCCARCCGCGCACGC
ATCGCGTGWTATGGTGAGGGCTTCTCTAATTATRCATCGTTGTATYAAAA
AAAATTGCACATATTATTTACRCATTTTTTTTAACCGTTAGATGAATCTC
AACAGCGGATATTGAAAGTTTAGATTATGTTACTTACGGTCCCAGTACAA
AAGTTACACCAACGTCTCGAATTCTTAGCCGTCRGGGTGGAGCGGCAAGT
GCAGAGTGAACTTCCAGCATAGAGAGAGGATTGAAATAAAAAATTGGAAA
AGAATTCGTCTTGTAACTCCAATTCAGTCTAACGTTTATTATTGATATGT
GTATATAAAATGTGTRTTTAGCGGTGCATTAAAGAAAATTTSGTGAYATR
AACAGGTTAACGRAGTAATTTTTATGTTTAGACATTTAAACTRCGTGATA
ATTCAGATGAAGATATATCGATTRGAAAATAACTCAAGCAGCATAGCATA
CGAATAGAACTCAAATGAATAAATGAAGCTGGAGATCCCACAATGAATAG
TTRCAAATAAAGAAATAAGGAAATTATTATAGAGTTTGAAGAACATTATC
ACTTGAATTTAAACTATTAACATGGCGCCAAGAATCACTCTATCTACACT
ACCATCAAATATTCATACACAAAAGTAATCAAATCCAACGAMTCAACAGC
TCTCAAATCTCACTAGTACTTGATCTAGACCGTCGATGGTCCTTCACAAC
ACCATCCATCGCTGAGCTCCCACCACCCGTCCGATCCTTAGACCCTCTCC
GCTTAAGCTTCCCATCCCCACCGTMAAAAACTTTCTCCAAAAACTCCCGA
ACCGAGTCTGGACTCAGATAACTCTTCCCCTGCAACAACCCCGAGAACGA
GTTCACGAACTCGGTGTAGGCMGGAATCACCAGCTTCACGGTAGCCGCCC
TAATCTGCTCCCGCAAATCAACGTCCGGAATTACACAAAACCCTCTATGC
CTCTTCGAAATGTCKTCCAAGCCCTTCATGAACGCCTCGATTTTCACCCT
CACCAGCGCCGCCTTCGCTGCCTTCTCCTCCTTGCTCTGSTTCTCCTCCA
AATCGTCCTTCTCCAGAATCCTCACCAGCGGGRCCCACGATTGCTTCTGG
TACAAGTAAGCGGATTCCTCGGCGACAACCTTGTAGTTGTTCCTCATGTA
GCCGTCGCCCAACAGCTTCCCGAGCTCCGTGTTCCTCGTCCGCATGTAAA
TGTACCAGTACGTGTTCATGCGGAACACGTGTTGYATGGGAATTGAAATG
CCCATTTTGTCCCTCTCCCTGCTGCTGTTGKTGTAGCCGGAACGTTTCGA
CTCCACGTTTCGCTGCAGAGCTTCCATGATGTTGCAAATRGCGTCTTTGA
GTAAGTTCTCGTAGGTTTCTGGCTTCGACAAGATCCCAGCTTTCCAGATT
TGCTCCGTTCTGAGAACTTTCGCCATGGGGATGCTGTAGTTTTCAGTTGC
TAAGTATTTCAAGTAGTTCACTGCGTACCTATTGAAGAATGTAAAAAGTG
GCACGTAAGAAATGTGACAAAATAACWTACAGTACATTTGAAGTATGGTG
CTTGAATCCTATAGAACTGATTTCTGAATTYGATAAAATGTGAAGTAATG
TTCCTTTTAATTCAAYTCCGTTATAATTTTTGTCAAAGATAAGTATGTGA
GACAAATTTTAACTTGTAAATTGGATACTTTATAGATGACSGYTCTAAAT
ACTTGTATGTCACATACTTAACTTTAACAAAATTCTCATGAAATAAGAGT
CAATCACCAATGCTCCATAATTTTCAAATTCAAGTGTTAGTTTTAATTAA
GAGATCAAAACTTGTGTTCGATAATAATTCATAACCAATACTCCAATATA
CTCGACTAATGATGTTCCGTYAATCCGTCTTTCTAACATTTTGACGTACC
TTACTATTTTCGGCACCGAACCATCTGGTGGTGGAGGCATTCCATCAGAA
TTGCCTTCAATTTGGAGCCCAAATTCCCAAAAAACTTTACTTGAAGCATG
AACAAGTAGCTTCTCCAGCTCCCTGAATCTTGTACAAATGTCAGTCCCCG
ATTCGCCATCAAAAACCTCCGAGAATCCAGGCTTCAGCTTCTCTAGGGAA
TCAAAMATTTCAAGGAGCTTGAACAGCTTCTGGGGCTCTTTSCTACTCCG
GGCAACGGCTTCRCCGAACCTGAAGAACACTGCCATKATTTTGTCTGCGA
TTTTGGCGAAGCATTCTGGCCATATCAGTCCCTCCATTATTCCTCCTAGG
ACTTGTTCGCAGAGCTTCTTCTCCGATACAAGAACTGCTTTGACTGCGAG
CTCGAAGTGCTGGATCCAAAGGGTTATGGCTGTCTCCAAGCTCTCCCATG
GCATTTCATCTATTTCTTCTGGTGTGTGTGTTTTTAGGTAATCCGGGTTT
AGCCTCATCAGTGCTTTGGCCACTCTTTTGTACCTCACCTRTTGAACAAC
AAGAAGCATAACAAKTAGAAATATAAAAYATAAAATTATAATTTGATAGC
ATCGGCTTGAAGTGGACTATTTCAATTAATTGAACCAATATTGTCTGGCW
AGTGTCGATTAATTTATAAATTTAAAAACATAGGCTCAWTAATTRGACTA
AAGTTGAACGTATCGTATCTTAAACTCTTTTAGAAATATGAGATTATAAA
ACTGTCTKAAACTTAATCYCARTCATATTCGGCCTCAAAAAGTATCTAGG
ACAATATTAATTAAAAATTCATTATCATATCATGCTAGGTCACAATATGT
ASGACCCTAAGCCCTTGGACTAATAGCTAAGGGTGCTGTTCACCCTAATA
TAGGTGGATAACAAATCACATAATTAAGAAGAAAACATTTCTCYAAGTGA
GGAAAAATWACCATTGTAATGAAGTTACCTTAACATAAATATCGATGCAT
ATRTCCAAGCAATCATCGGCAGCTAGGGTTTGTGAAATCCTTCTGAGAAG
TTCAACCTCCAACTCAGTCCCCAAATCCGAACCCACGATCGCTATCTCAT
YCCTCCGGTCAYCTTTATCCGAAGCAGCYTGCAAATCCACCACATTCCGA
TGYTTAATCTGCTCCARTATACTCTCATACTCGTCCTGCAAATTCAGCAG
CGCGTCATCRAGCAACCCTTCAAACCTCATGGCGTCCACCTCCGTCTCGT
ACAGCGCCTTGAGAGTCACCAGCGTCTCCCTCAGCCGGTGAGTCCTGTAC
TGGTCSGTCGCCTTCGTCCGGCTCAAAAACTCCACSACCTCTTGCAGCCT
CTGAATCACTGGCTCRCCTTCTTCGCAAATACAGCTAATCGCAATTTTCA
ACTGATCCACGCAGTCCACGTACTTGACAAGCTTCTTGAGCCGTTTCTTC
CTTGACTTCTCGCTGGACAACGTCTCCGCGAGATCCAAGAGCTTGTCCTG
GATGGTCTCGGAGAGCTTGAARTTGTCGAGAAGCGCCAGGGCCGGCGTGA
CAGCTCGGTTGATTCTGGTTTCTAAGGCTTTCGAGGCCATGGCTAGTGAT
TGTATAGGAGCTACTCTTTTAGACGCAGTTAGAAGCGTTTCGTCTATGAC
TTCGAACTTGTTGTCCATCTGTTGAAGATTTTCCTCCATTTTCGCCGTCG
CTGTTAGGAGAGTTTTCAAATCGGAACATGCTAGCTCGAGATCGGAGAGC
CTCGAATCGGCTGACCTGTAATTAGACGCCATTGTTAACCGTGATTAAGG
TYGAATGGTTTTTTGTATTGTGTCGTGTGTGTTTATATGATCGTCTCACG
ACGAACACGATGTGTTTGTGGGGGCACAGGACAAGGRAGTAAAATCATCA
GGCTCGATGCAAACTAAAAGAACAACAAATGGCATTTGTGTGTTGGAAAM
GGACAAATGGGTAACTTTCGAAGATTAGCAGRGGGGAATGTGCTCCGACG
GTGGAGAAWTTTTTWCCTGGACACTTGTCGCCTTKTATATTATTTTAAGT
GTTATAATATATACCRACRACAATATYAGTACTTATTCAGAGTAAATTAA
AACAWATCATCACATTATACTTGTGTATTGAAAATAAACACAMCATAGTC
CTGGTCTGAGGATATAAAAATGAATAATACKTGACTACTTAAAAGATGAA
TAAGAGTTTATGTTAAAAATTGTTAGTGATTATTTTACAAATTTTTGTGT
TTATGATTAGAACTATTCATATTATAAATCACTCTATAAGTTCGTCTCTG
CAAAAATCAACTAAAACTAAGGTTATCTAGTCGTCAAACTGTATAAAACA
GATGAATGAAATTGATAGAAGCATTACGAACTGTGTATGTATTTGCTATA
ATAGATTGATTAAACAAACATAATTTTAATTCATTTTTTGCAAACATGAT
CTTTACAAAATGATATATAATATAAACGATTCTGATCATAAATATAAAAC
TATATAATTCAAATACAAAAAGATTTGAATAGAAACTCAATATTGTGGAC
GGAGGAAACAATCCACTGCCAATAGTGACTATTCAACGCAAAAGATATAC
TATGGGCCGTGTAGCAACGGCAA
back to top