MDC013447.198, MDC013447.198 (contig) Malus x domestica

Contig Overview
NameMDC013447.198
Unique NameMDC013447.198
Typecontig
OrganismMalus x domestica (Apple)
Sequence length19020
Analyses
This contig is derived from or has results from the following analyses
Analysis NameDate Performed
Malus x domestica Whole Genome v1.0 Assembly & Annotation2012-07-26
Alignments
Feature NameTypeLocationAnalysis
MDP0000436554 mRNA MDP0000436554:8000..9802+ Malus x domestica Whole Genome v1.0 Assembly & Annotation
MDP0000436554_exon_1 CDS MDP0000436554_exon_1:8000..8164+ Malus x domestica Whole Genome v1.0 Assembly & Annotation
MDP0000436554_exon_2 CDS MDP0000436554_exon_2:8644..8794+ Malus x domestica Whole Genome v1.0 Assembly & Annotation
MDP0000436554_exon_3 CDS MDP0000436554_exon_3:9405..9802+ Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_CT_27490010_Lg14_01213_MAF40_508966_exon2 genetic_marker RosBREEDSNP_SNP_CT_27490010_Lg14_01213_MAF40_508966_exon2:11753..11753. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_AG_27481499_Lg14_01213_MAF40_MDP0000623022_exon1 genetic_marker RosBREEDSNP_SNP_AG_27481499_Lg14_01213_MAF40_MDP0000623022_exon1:3242..3242. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_GA_27487573_Lg14_01213_MAF30_1647799_exon1 genetic_marker RosBREEDSNP_SNP_GA_27487573_Lg14_01213_MAF30_1647799_exon1:9316..9316. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_GA_27479804_Lg14 genetic_marker RosBREEDSNP_SNP_GA_27479804_Lg14:1547..1547. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_GA_27479806_Lg14 genetic_marker RosBREEDSNP_SNP_GA_27479806_Lg14:1549..1549. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_AG_27479815_Lg14 genetic_marker RosBREEDSNP_SNP_AG_27479815_Lg14:1558..1558. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_TC_27479818_Lg14 genetic_marker RosBREEDSNP_SNP_TC_27479818_Lg14:1561..1561. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_CT_27479830_Lg14 genetic_marker RosBREEDSNP_SNP_CT_27479830_Lg14:1573..1573. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_CT_27479838_Lg14 genetic_marker RosBREEDSNP_SNP_CT_27479838_Lg14:1581..1581. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_GA_27479843_Lg14 genetic_marker RosBREEDSNP_SNP_GA_27479843_Lg14:1586..1586. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_GA_27479860_Lg14 genetic_marker RosBREEDSNP_SNP_GA_27479860_Lg14:1603..1603. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_CA_27480624_Lg14 genetic_marker RosBREEDSNP_SNP_CA_27480624_Lg14:2367..2367. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_GA_27480629_Lg14 genetic_marker RosBREEDSNP_SNP_GA_27480629_Lg14:2372..2372. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_GA_27480637_Lg14 genetic_marker RosBREEDSNP_SNP_GA_27480637_Lg14:2380..2380. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_GA_27480653_Lg14 genetic_marker RosBREEDSNP_SNP_GA_27480653_Lg14:2396..2396. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_AC_27480660_Lg14 genetic_marker RosBREEDSNP_SNP_AC_27480660_Lg14:2403..2403. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_AG_27481499_Lg14 genetic_marker RosBREEDSNP_SNP_AG_27481499_Lg14:3242..3242. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_AG_27482365_Lg14 genetic_marker RosBREEDSNP_SNP_AG_27482365_Lg14:4108..4108. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_CT_27482388_Lg14 genetic_marker RosBREEDSNP_SNP_CT_27482388_Lg14:4131..4131. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_AG_27482393_Lg14 genetic_marker RosBREEDSNP_SNP_AG_27482393_Lg14:4136..4136. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_TC_27482408_Lg14 genetic_marker RosBREEDSNP_SNP_TC_27482408_Lg14:4151..4151. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_CT_27482435_Lg14 genetic_marker RosBREEDSNP_SNP_CT_27482435_Lg14:4178..4178. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_TC_27482438_Lg14 genetic_marker RosBREEDSNP_SNP_TC_27482438_Lg14:4181..4181. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_AG_27482446_Lg14 genetic_marker RosBREEDSNP_SNP_AG_27482446_Lg14:4189..4189. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_GA_27482457_Lg14 genetic_marker RosBREEDSNP_SNP_GA_27482457_Lg14:4200..4200. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_GA_27482467_Lg14 genetic_marker RosBREEDSNP_SNP_GA_27482467_Lg14:4210..4210. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_GA_27482669_Lg14 genetic_marker RosBREEDSNP_SNP_GA_27482669_Lg14:4412..4412. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_CA_27482673_Lg14 genetic_marker RosBREEDSNP_SNP_CA_27482673_Lg14:4416..4416. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_CT_27482682_Lg14 genetic_marker RosBREEDSNP_SNP_CT_27482682_Lg14:4425..4425. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_GA_27482683_Lg14 genetic_marker RosBREEDSNP_SNP_GA_27482683_Lg14:4426..4426. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_GT_27482687_Lg14 genetic_marker RosBREEDSNP_SNP_GT_27482687_Lg14:4430..4430. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_CT_27482695_Lg14 genetic_marker RosBREEDSNP_SNP_CT_27482695_Lg14:4438..4438. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_CT_27482700_Lg14 genetic_marker RosBREEDSNP_SNP_CT_27482700_Lg14:4443..4443. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_CT_27482706_Lg14 genetic_marker RosBREEDSNP_SNP_CT_27482706_Lg14:4449..4449. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_GA_27482708_Lg14 genetic_marker RosBREEDSNP_SNP_GA_27482708_Lg14:4451..4451. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_CA_27482733_Lg14 genetic_marker RosBREEDSNP_SNP_CA_27482733_Lg14:4476..4476. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_GA_27482739_Lg14 genetic_marker RosBREEDSNP_SNP_GA_27482739_Lg14:4482..4482. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_CT_27482741_Lg14 genetic_marker RosBREEDSNP_SNP_CT_27482741_Lg14:4484..4484. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_GT_27482746_Lg14 genetic_marker RosBREEDSNP_SNP_GT_27482746_Lg14:4489..4489. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_AG_27482758_Lg14 genetic_marker RosBREEDSNP_SNP_AG_27482758_Lg14:4501..4501. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_AC_27482835_Lg14 genetic_marker RosBREEDSNP_SNP_AC_27482835_Lg14:4578..4578. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_TG_27483176_Lg14 genetic_marker RosBREEDSNP_SNP_TG_27483176_Lg14:4919..4919. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_AG_27483183_Lg14 genetic_marker RosBREEDSNP_SNP_AG_27483183_Lg14:4926..4926. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_GA_27483192_Lg14 genetic_marker RosBREEDSNP_SNP_GA_27483192_Lg14:4935..4935. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_AG_27483350_Lg14 genetic_marker RosBREEDSNP_SNP_AG_27483350_Lg14:5093..5093. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_GT_27483380_Lg14 genetic_marker RosBREEDSNP_SNP_GT_27483380_Lg14:5123..5123. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_GA_27483452_Lg14 genetic_marker RosBREEDSNP_SNP_GA_27483452_Lg14:5195..5195. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_TC_27483470_Lg14 genetic_marker RosBREEDSNP_SNP_TC_27483470_Lg14:5213..5213. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_TC_27483475_Lg14 genetic_marker RosBREEDSNP_SNP_TC_27483475_Lg14:5218..5218. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_CA_27483529_Lg14 genetic_marker RosBREEDSNP_SNP_CA_27483529_Lg14:5272..5272. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_CT_27483543_Lg14 genetic_marker RosBREEDSNP_SNP_CT_27483543_Lg14:5286..5286. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_GA_27483545_Lg14 genetic_marker RosBREEDSNP_SNP_GA_27483545_Lg14:5288..5288. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_TC_27483558_Lg14 genetic_marker RosBREEDSNP_SNP_TC_27483558_Lg14:5301..5301. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_TC_27483906_Lg14 genetic_marker RosBREEDSNP_SNP_TC_27483906_Lg14:5649..5649. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_TG_27484124_Lg14 genetic_marker RosBREEDSNP_SNP_TG_27484124_Lg14:5867..5867. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_TC_27484129_Lg14 genetic_marker RosBREEDSNP_SNP_TC_27484129_Lg14:5872..5872. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_TC_27484164_Lg14 genetic_marker RosBREEDSNP_SNP_TC_27484164_Lg14:5907..5907. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_CT_27484286_Lg14 genetic_marker RosBREEDSNP_SNP_CT_27484286_Lg14:6029..6029. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_GA_27484292_Lg14 genetic_marker RosBREEDSNP_SNP_GA_27484292_Lg14:6035..6035. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_AG_27484322_Lg14 genetic_marker RosBREEDSNP_SNP_AG_27484322_Lg14:6065..6065. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_CT_27484340_Lg14 genetic_marker RosBREEDSNP_SNP_CT_27484340_Lg14:6083..6083. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_TC_27484359_Lg14 genetic_marker RosBREEDSNP_SNP_TC_27484359_Lg14:6102..6102. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_AG_27484363_Lg14 genetic_marker RosBREEDSNP_SNP_AG_27484363_Lg14:6106..6106. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_GT_27484365_Lg14 genetic_marker RosBREEDSNP_SNP_GT_27484365_Lg14:6108..6108. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_AG_27484373_Lg14 genetic_marker RosBREEDSNP_SNP_AG_27484373_Lg14:6116..6116. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_TC_27484395_Lg14 genetic_marker RosBREEDSNP_SNP_TC_27484395_Lg14:6138..6138. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_TC_27484430_Lg14 genetic_marker RosBREEDSNP_SNP_TC_27484430_Lg14:6173..6173. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_GA_27484454_Lg14 genetic_marker RosBREEDSNP_SNP_GA_27484454_Lg14:6197..6197. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_TC_27484473_Lg14 genetic_marker RosBREEDSNP_SNP_TC_27484473_Lg14:6216..6216. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_AG_27484502_Lg14 genetic_marker RosBREEDSNP_SNP_AG_27484502_Lg14:6245..6245. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_AG_27484511_Lg14 genetic_marker RosBREEDSNP_SNP_AG_27484511_Lg14:6254..6254. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_CT_27484559_Lg14 genetic_marker RosBREEDSNP_SNP_CT_27484559_Lg14:6302..6302. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_CA_27484586_Lg14 genetic_marker RosBREEDSNP_SNP_CA_27484586_Lg14:6329..6329. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_TC_27484591_Lg14 genetic_marker RosBREEDSNP_SNP_TC_27484591_Lg14:6334..6334. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_AG_27484971_Lg14 genetic_marker RosBREEDSNP_SNP_AG_27484971_Lg14:6714..6714. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_TG_27485020_Lg14 genetic_marker RosBREEDSNP_SNP_TG_27485020_Lg14:6763..6763. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_AG_27485022_Lg14 genetic_marker RosBREEDSNP_SNP_AG_27485022_Lg14:6765..6765. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_GA_27485043_Lg14 genetic_marker RosBREEDSNP_SNP_GA_27485043_Lg14:6786..6786. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_AG_27485078_Lg14 genetic_marker RosBREEDSNP_SNP_AG_27485078_Lg14:6821..6821. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_CT_27485083_Lg14 genetic_marker RosBREEDSNP_SNP_CT_27485083_Lg14:6826..6826. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_AG_27485090_Lg14 genetic_marker RosBREEDSNP_SNP_AG_27485090_Lg14:6833..6833. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_AG_27485121_Lg14 genetic_marker RosBREEDSNP_SNP_AG_27485121_Lg14:6864..6864. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_TC_27485134_Lg14 genetic_marker RosBREEDSNP_SNP_TC_27485134_Lg14:6877..6877. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_TG_27485179_Lg14 genetic_marker RosBREEDSNP_SNP_TG_27485179_Lg14:6922..6922. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_TC_27485182_Lg14 genetic_marker RosBREEDSNP_SNP_TC_27485182_Lg14:6925..6925. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_GA_27485210_Lg14 genetic_marker RosBREEDSNP_SNP_GA_27485210_Lg14:6953..6953. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_CT_27485215_Lg14 genetic_marker RosBREEDSNP_SNP_CT_27485215_Lg14:6958..6958. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_GA_27485246_Lg14 genetic_marker RosBREEDSNP_SNP_GA_27485246_Lg14:6989..6989. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_CT_27485247_Lg14 genetic_marker RosBREEDSNP_SNP_CT_27485247_Lg14:6990..6990. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_GT_27485445_Lg14 genetic_marker RosBREEDSNP_SNP_GT_27485445_Lg14:7188..7188. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_AG_27485453_Lg14 genetic_marker RosBREEDSNP_SNP_AG_27485453_Lg14:7196..7196. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_AC_27485545_Lg14 genetic_marker RosBREEDSNP_SNP_AC_27485545_Lg14:7288..7288. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_TG_27485589_Lg14 genetic_marker RosBREEDSNP_SNP_TG_27485589_Lg14:7332..7332. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_GA_27485608_Lg14 genetic_marker RosBREEDSNP_SNP_GA_27485608_Lg14:7351..7351. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_AG_27485616_Lg14 genetic_marker RosBREEDSNP_SNP_AG_27485616_Lg14:7359..7359. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_GA_27485619_Lg14 genetic_marker RosBREEDSNP_SNP_GA_27485619_Lg14:7362..7362. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_GA_27485637_Lg14 genetic_marker RosBREEDSNP_SNP_GA_27485637_Lg14:7380..7380. Malus x domestica Whole Genome v1.0 Assembly & Annotation
chr14 chromosome chr14:23229802..23248821+ Malus x domestica Whole Genome v1.0 Assembly & Annotation
Sequences
The following sequences are available for this feature:

contig sequence

>MDC013447.198 ID=MDC013447.198|Name=MDC013447.198|organism=Malus x domestica|type=contig|length=19020bp
ATGCACTGCTCGGTCGAGACTGGATTCATCAAACCAGCTGTATTCCTTCA
TCATTGTATCAAGTGCTTGTTTTTTGGGACGGCAACTCGGTCACTGTTCA
CCTGGCTGATAGCCAGCCCTTCGAAGCTAACATGATCCAAGCACGGTATT
ATGATGACCACGTCGGCTACATTACATTGCAAGGCTTCAATGAAGAAGGA
CGACCGACTCGGATTTCTATCCAGAAAGCTATCGAGGTTGGCGCCGAGAC
TGTCCACCAGGATTCGGCGAGACTCGGATTAGCCAACTTTCTCCCCGAAG
CCGATGTTTGACACCAACCGGGAGGAACAAAGGGCCGCGGTTTCATTTAC
TATGGAACGACTGCTGCCCATTGGTATACTATATCTCAACAACCAAATTC
GGGCGTTAACCTTGTTGAGTTCCTTGCGGAAGGAAATAATGGTCCCGTCT
TATCCCTTGACAAAGTTTGAGCCGCCCCGGCCGAGCTCGAGGATCATCAG
CCCCAAGTTAAGGACCCCCTAGAAGAGATTAATGTTGGGACGGCCGACGA
CCCACGACCTTTGTTTATTAGTGCGTTACTTCCCCAACAAATGAAGGACG
AACTTCGTGCCTTGCTTACAGAGTTCAAAGATTGTTTTGCTTGGAGCTAC
CATGAAATGCTCGGCTTGGATCGCACTCTTGTCGAACATGAATTACGTAT
TAAGCCCGGATGCAAACCTTTCCGGCAACCACCTCGTCGATTTTCGACCG
AAGTACAACTCGGCATCAAGGAAAAACTGGTTCGACTTTTGAAAGCCGGG
TTCATTCGGACAGCTCGATATGTGGAATGGTTGGCGAATATCGTTCCTGT
CTTAAAGAAAAATGGTGCACTGCGCATCTGCATCGATTTCAGGRATCTGA
ATCTGGCAACTCCCAAAGATGAGTATACAATGCCGATTTCAAATCTATTA
ATCGATGCCGCGGTGAATCATGCGATTTTATCCTTTATGGATGGACACGC
CGGGTACAACCAAATTTTCATTGCTGAAGTCGATGTGCACAAAACTGCTT
TTCGCTGCCCGGGGGCACTCGGCAATTACGAATGGGTTGTTATGCCATTC
GGCCTAAAAAATGCAGGCGCCACATACCAACRGGCGATGAACACCATATT
TCATGACTTAATTGGAACCAYGAAGTCTATATTGAYGATGTTGTGATTAA
ATCCAAACAACGGCGAMCTCATGTGGATGATCTCCGACAGGCTTTCCTTC
GTATGCGCCAACACAATCTCAAAATGAATCCTGCCAAATGTGCATTCGGT
GTGTCGACCGGTAATTTTCTCGGTTTCCTGGTACATCACCGTGGGATTGA
AGTGGACGAAAATAAAGCACGTGCAATCATCAGTGCTCCACCACCAACTA
CGAAGAAATAGCTGCAGTCCTTACTCGGCAAGATAAATTTTCTCCGTCGA
TTTATAGCTAACTCGACAGGAAAAATGAAAGCGTTTTCCACGCTTTTGAA
ACTTAAGGACTCGGATACATTTGCGTGGACGACCGAGCATCAGGCGGCGT
TTACACAAATTAAAGTCTCCCTCACAACGCCGCCTGTTCTTGTTCCACCT
CGGCGCGGTAAACCCCTCAAACTATATATTTCGGCGGCTGAAGAGTCCAT
CGGCTGCCTCCTTGCCCAAGACAATGATGCAGGCCGAGAGCAGGCTATTT
TTTACCTCAGTCGAAATCTTAATCCACCGGAGATCAATTATTCCACCGTG
GAGAAGCTCTGTCTTGCCGTGTTCTTCGCCGCCTCCAAACTTCGGCATTA
CATGCTTCCGTCGGTCACACAAGTCATTGCCCAGACTGACGTCATCAGGT
ACATGCTTACCCGGCCAATCGTAAAAGGGAGAATTGGGAAGTGGACGATG
GCGTTGTCCGAGTTTAGCCTACAATACGTGCCTCAGAAAGCTGTCAAAGG
CCAAGCATTGGCCGATTTCCTGGCTCACCATCTTTCCCCCTATGGTTTTG
GGGACACCGATGTCGAAATTGGCATGGTTGAAACACGCGACAACTATTGG
ACAATGTATTTTGACGGGTCCAGTACTTCATCCTCGGCCGGCGTTGGAGT
TGTCATTCAATCTCCTAATCACGATCGTTGGTATTTTTCGCTTAAGTTGG
ATTTTGACTGCACCAATAATCAGGCCGAATATGAAGCCTTAATCATCGGC
CTTGGCCTCCTTCATGACTTGCGGGCCACTCGTGCCCTCGTCCTCGGCGA
CTCTGAGCTTGTGATTAACCAACTTAATGGATCTTTTCGCTGCATGAGTT
GTACCCTGGCACCCTACCACATGGTTGCCAGCTATTTGGCCGAGTCCTTC
GACGGTATTACGTTCGCACATGTTTCCCGGATCCATAATACCGACGCAGA
TGAGTTGGCTCAAATTGCCTCTGGTGCACAACTCCTGGGGGGCAAGCTAG
GCTGAGAAATACCGGTGTTACGACAATTATAGCCGGCCTTGGTCAACCAG
CAAATCCTCCGGCGCGACGATGTAATACGCACTCGAGTCATGTCTTTACC
TTCGTTGTTAGACCGACAAGATACTATAGAGGTTTGCACCGTCGAGGCAA
CACCAGATGATTGGAGAAAGCCCATTGTGCAGTACCTTGATAATCCCAAT
GGAAAACATAGTCGCAAGACACGAGTCCACGCCACGAACTATGTCACGTA
CCAAAACGAGTTATACCGAAAAGGGGAGGATGGATTGCTACTGCTATGCC
TCGGCCCCCAAGAGGGTGCTCGGGCGATCTCGGAAGTCCATGAAAGGGTT
TGCGGAGCTCATCAATCTGGACGGAAAATGCGATGGCTACTTCGACGACA
CGGTTATTTTTGGCCAAAAATACTAAAGGATTGTATCGAGTTTGCACGAG
GATGCGTACAGTGCCAAATCCACGGGCCTAGCCGAATCATTGCATTCGGT
CATTAAACCATGGCCGTTTAGAGGATGGGCTATGGATGTAATCGGTAAAA
TTATGCCATCCTCCGAAGCTGCCAAACACGCATGGATTATAGTGGCAACC
GATTACTTTACTAAGTGGGTCGAAGCAAAATCATATGCCGAGCTAACGTC
TAAAGAAGTTTGCGACTTCGTGGAGGAACACATTGTGACCAGATTTGGCG
TACCAGAAACGATCATAACTGACAATGGAACGATCTTCACAGCCGAAAGG
TTTAAAGAGTATACGGCAAGTTTAAAAATTCGGCTCGAACAATCTACACC
GTATTATCCACAAGCGAACGGGCAGGCCGAGGTAAGTAATAAAGTGCTGA
TCGGCATCCTCGAAAAAAATAATAAAAGAAAGACCCGGCATGTGGCATTT
GAAGTTGAACGAGGCATTATGGGCATATCGAACGTCGCCCCGATCGGCGA
TTGCGACAACCCCGTATGCATTAACCTACGGACATGATGCAATGTTACCA
GTTGAGTTAAGCATAAATTCGTTGCGATTAACTGAACAAAGTAGTTTGTT
CAGCGCCGAGTATAATCAGTCCATGAGACAGGAGTTGGAAGATTTGGAAG
AAGCACGACTTGACGCTTATAACTTACTGGTGGCACAAAAACGGATTGCC
GAACGAGCCTATAATCAAAAGGTACGTCAGAAAACATTCGGCGAGGGTGA
ACTGGTTTGGCAAACGGTGTTACCCGTAGGACTAAAAGACCCTAGGTTCG
GCAAGTGGTCGCCAAATTGGGAGGGGCCGTTCGTTGTACATAAAGTATAC
GGTAAAAGGGCGTATCATCTTAAAGACCGGACCGGTATAGTGCACAGATT
ACCAATCAATGGGAAGTTTTTAAAGAAATACTATCCGGTCACATGGGAAA
TGCGGGAATAGAAAATCAATTCATTAATATTGGTAAGCATGTACAAGACG
ACTGAATTGATCATTTTTACATYCAAGTGCCTTTAAGGCGAAGAGGGTAG
RAGGGTGCCGAGCAGGGCCTTCAACTCCAACCACCGCACCTCGGCCATGA
TAACTTCAGCTTGCCGATTCCTCTTGTCCAGCTTYAACCGCTCGACCCGT
TTTGTGATCGCCGCGTACTCAGTTAGGCAATCCTTTCCGCCCGATTCGAA
GTCTTTAACAAGCTCGGAAGCAATGGTCGACCGACATTTTGCTAGTTCGG
TCATCTGACGGTCGAGCTCGGCTAAGGCGTTTCCTTTTACCCTTAGATCG
TCGATTTTCGGACGGAGAGTGTCTTGAACGGCCGTGGCAGCTTGCAGGTC
GTGTTCGGCCTTTAGAGCGGTCTGGAAGATACTAAATGTCTCCCGAACCC
GCTCCAAGGCAGACGACGCCCGAACGATGGCATCTCCGCTCAGGCGACCG
TTGGCTCCAAGGTCGTTCAGACATACGCCAAGCAGATCAAGACCGTTGCG
CTCGAGTACTTGCGACGTTGAAAGCGACAGGACTTCTCGCAACTGAGTCA
GAGCGCTTGGATCGGCAGCTTCAGTCGTAGCGGCCGAAGGACCGGACTCT
ACAGTTGTGCTGGAGATGAGGGCTTTGAATTCGACCTCCCACGAAGCCTG
CACATACAAATCAGGTTAAGCTTAAAAAAAGTCATGAATAGCAAGAAGGT
TTCGTTTTTTAACCTGCCGAGAGGAGACCTCGGCCATATCTCCAGGATCG
TTGCTCGAACCTAAAGAACTCAATGGCCGAGCCCAGTGTCTCAGGGTGCT
TCTCAGTTCACGCGGCTGATGGAGGTTATCTACGTTTGATGGCCACTGAG
GCGGCCAAGAAATATAGATAACGCCCTTCGACGCGTAGAATTTTCGATGA
AAAGAGTGTACAGGCACCTAACATTTAGTATTTTCTTCGTTTAGAATTCT
AAAGTAGAAAAGCAATCAAGGAAATACGGTAGAAGGTACTTACGAAGGCC
GAAGTAACCTCCTGCGGATGAATGTAGAAGCCCTGGTCTTGAGGATGAAC
GGGCGACTCCGCCGTTGCCTCGGGTTCCTCGGCTGGTCGTTTGCCACGGT
CGGCTGTGGAGGGGCCGACCGGGACAGCCGCTTCGGATGAGGCAAGGACA
TCCTGGTCCTGAGAAGGAGCGAGGGGTTCGGCCACAGCTGTTAGTTCCTC
GATCGGACGCTTACCACGATCAGCCGTGGAGGGGCCGGCTGGAACCACCA
TCTCGGAGATCGGAGGAGGTTGTCGGCGAGTATGAGGACGATTTGCAAGC
GGGACCTCATCGTTCCCTTCACTTTCTTCCATAATTAAGACCGAGGGCTT
TGGATTTTTAGGGGAAGTTCCCTCGGTCACAGAAACCGCCTTTTTCGGAA
TAGGTGCCTCCTCGACAGAGGGAGGCACAACTGGTATACCGGCCCCAGAA
ACAAGCCGCGTTTGAACTGTTTCTGCGGCCGGAGCTGGCGGTTTCTCAAC
CAAGGGTTGGTCGATAGCAGGAGAAAGGGAAACACTGGGAGTCGTCGCCC
CTGTAGTTTGACTGGAGATGACGTGGATCTCCCGTGCGCCCTTCTTTGCC
AGCTATTTTACCCGCTTGGTAGGCGGCGGAGGTTCGACGGCTGGCTCGGC
CTCTTGGTGAGGCCGTTTGGTCAGCGCAGCCCGACCAGCAGTTTTATCCT
TCTTAGTTACGACCGATTTTTTCTCGGCCGTAGCCACGGCAACTGCCTTC
GTTTTTCTCAAAGGGCGACTACCTGAGAAGATAAAAGCAATTCAGTAAAG
CAAATCAACATGCAAAGWAAAAAAAAAAAAAAAAAAAAATTGAACAGGTA
CCTGGAGCTTGGGGGGCCGRGGCCTTCTTAGGTCGATCACCGAAGAGTTT
GCCCAGCACATCTTCGACCGGAGCACCAAAGAACTCCTGGGTGTAATTTT
CCCACCAATCACCGAATGTGTTAGTGCAAAGGGTTTCTGGGGTGGCCAGT
CGAAGGTGGAATTTTTGGCAGTGCTCTTGGAACTCCCTCGCAGCAGTTTT
ACATTCCTTCTCCGAGGAACGAGGTTCACGTCCACGGCTTAGGACTGTTC
AGGAGGAGAGAAGGGGAACCGGGCAGCCCTGGAGGTAGCCGAGCTGTCGA
GCAAGGAAGTTCGGATGGTACACTTCCCAACCCGTTCGTTTTCCATCGCA
GTCGAAAGGGAGGTCACGAGTGAGCACAAACGACCCCTAGGTCTGACGAA
GATCGGCATCCTCCCCCGCGCCTCACATGGAGGTAGGCAGTCTGATGGAG
GAAGGATAGTCTCGATGACGACATATCAGGAATTCGTCGTTGGAAAGGTC
ATCAAGAGCGAAGAGGTACCGAAATACCTCTTCGGCTTGATGAGGAGGTG
TCGGTCGGGAGGCCAGCTGAGGTCCAAGCGCCTTCGTTGGCGAGAAGTCA
GCTATGGCCGGCCGAAGGGAGGCGAAGTAAACTTGTAACCAGAGTTAGAA
GACCTAGAGGGGACCATTCTGGTGTGGGTCGATCTTGTGGAGGGTCGCCT
CGGCCAGGCAGCGGAAGAGATGGGCGAGAATGTTGGAGCTCAGTGCCAGG
ATGTGACCACTAGCCAGGGCCTCGGCTACCGGCATGTTCTCGACCAAACA
TTTGTTTGACTTGGTACAACAAATGTACTTGTTGTACCAATAGAAGAGGA
ACGCTTCATGTTCCCCTTCTCGCAGGTCCTCTTTTCCTCGGCCGGCGAAA
TGGAGATAGAGGGTGTTGTAATTGAAAAAGTTCTTGTGGAGCTTCTGAAT
GTCTTCCTTCGACAGGATTTGACCTTCACGATTCAACGTCTCGAAAGCCC
GTCGATCAAAAATCATCTTCAGGTCGATATTCGACGGGTACCCAGAGAGG
GCCGCGTCGATAGGGATCCCAGTTGCCGAAGTACCCAGAATGGCGGTAAC
ATCAAGAATGGTGAGACCGATGGGACTAAGAGGAAGAACCATGGTGTTGG
TGGCCGAGCACCAGAAGCATATGGTGGCTAGGAGAAGCTCCTTGTCAGGA
ACGACATCCATTGACGAGAGGAGGATGGCGTCGTAGATGCCGAGGGCTTT
CCATTGCTCGCCAAAGAGCCGTTCCATTCGAACAACCCAGGCTGCCCAGG
TTGTGGTCGTCGAGGGCCAGGAGCCTTGGGGTTTCGCCGCATCCCATCTC
GACCATTCAAACCCTTGGAGCAAGGGTGTTAGGCAGTGCTCCTGGAGAAG
GCCAGTAATGGTCAACGGGATTGTAGCTTTGAAGAGAGGACCCAAAATTT
GGTGGACAGTGCTCATGTCACTTTCAAACCGTATGGTTTTGATCGAGCTC
CGATCAAGAATTTTCTGATGCTGTTCGCATTCCCTGGAAAGCTTGGAAAT
GAAGGACGCCATTGTAGGAAGGAAGCACGGCTTAAAAGGTTTTCTGGGTT
GGGGATTTAAAGACGAAGACCTGGAAAGAGAAATGTGCTGGAGAACAAGG
ACAAGAAATTTCGAAGTGATTTTGGAAGCGTAAAGTATGAATAAGGGATT
TCAGTATTTATAGGATTTTGGCAGGAAGGGCAATCGTTCGAAATTCAAAA
CAAAGGGCAAAATCGACCGAAGGAATCGCTCATCATGATGAAATATTTGG
GAAATGCAGTTGAGAAGACCGAAGGTCTCAGGTGTTGGGGGCGCACAATT
GCGTGTGACGGCGAAATTAATGGCGAAGAAACATTTCAACGCATGCACGA
TGATGAGTGGCTCGCGGATTGAGGTAGTGGCCATAGGGTCATAATGGCAA
GACGGTTCAGGCAGCCGCACGCCTTAGACGTCATTATTAGGGAATGGCCG
TGTTTGAGGACGCCACGTGGCGAGTTTGGTTAGCAGAATCAAGATCGTGC
AGTCATGTTCAATAAATGCGCCTTGGAACTCAGGCACTGGGGTTCTGAGT
GGTAGATTCGCTTCTTCAAGGCCGAAACTCGACCGAAGAATTCAGGCCAA
GGACCTCAGAAGCGAGGGGGCAATGTTTGGGCCCAAATTAATAATTTGGG
CCGAGGGTAGGATCATTCTCGGCCCGGGAGGCCGTGCGACGAAAGGGCCA
TGGATCGTTCAGCTCATGGGCTTCCAAGCCTAGGTCGGTTAAATCAGAAC
GCAAGTCGAGTCCTAGTACAACAGGGAGTCTCGACGGGATCAGTAATCCA
GAAAGCGAATCCGGCTCAGTTAAAGACTAGATTCGTAGTCCTAGTAAAGA
TAGGACTGGTCGAGGTGATGTTGATCCGGAGAGGAAACCTAGTCCGAGTA
GGATTTTAACTCGGACTCAAGGTCCAGTACTATAAANNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNCCGGTGATATCTTAAGTCGGCATA
GATAGCTCTGTCACCGTAGAATCAGTCGGTCTCGCAGTATCTTCCGTTGG
CATCAACAGCACTGCGGCGAGAACGACTGATTACCTATCCAAGTCTCGGT
CGAGAAGGATTTCTGAATCCTTATTGGTCGAGGTCATCTCATCAGCCTTC
TCGGCGAAGTGAGGTGTTACAAGTGATTACATTCGGCACGTTGAAAGCCG
AATTTGATATTGAACTTCGTAAAAATAGTAACCTTGTCTTCAGGTTCGAG
AGCCCAAGAGGCCGAGACGCGTTCCTTTCTCGGCCGCAATCGCAAGACGC
AGAAGTCAGCTGCGCACCCAACGCAACACCAACAAATTTACTCATCGGCC
GAGCTCAGCCGACGAGTTGGCAAGCCCCGCAATCACCGAAGGACGTAGTT
AGCTTATAGATTACTCGGCCTGCGCGCCACGTAGGCTTTGTAGTTTCTAG
GGTCAACAGAAATGCATTGCATGATAGATATAACTGATTTAAGTTGATTA
TATAGCGAGCTGACAAACATTGTGAGTGTAGAAAATATGTAGTAATTAAT
GAAAGAAGTTTAAACACACCATAATCATTTATATATAATGAATTAGTATA
ATATTTTACACTTTATACATTGCATGGTAAGATACATAAGTGACTTAGCA
AGGTCTAAAATATCGATGATATCAGAAATATCAATAGTCCAAGAAAATAT
CGATAATCCAAAAACACGGAAATTTCGATGGAAATATCGGGATATTATGG
ATATTTTAGACCATACTTCTGGATAATTGCAGAAGTCTCTGCAACTCTCG
GAGAAATCTTCTATGCCATCATATATATATGTGTACACCCCAACCTGATC
AGATAGAATCGTCTAAAGCAACCAAAGCAAAAATACCTCACTCAAATCCT
TCAAATTTGATACCCGGCAGAAACCCAACATCCAATGGCTCTCAGTCTCT
TTGGCAACGGCCGATGAAGCAGCGTTTTCGACCCCTTCTCTCTTAACATC
TGAGACCCGTTCAAGGGTTTGGGCACTCTGGCCAACTTCCCCTCCTCCGC
CCGTGAAACCACCGCCATAGCCAACACCCGCATCGATTGGAAAGAGACCC
CGGAGGCCCACATCTTCAAGGCGAACCTCCCGATGATCAAAAAGGAGGAG
GTGAAAGTGGAGGTGGAGGACGGGAGGGTCCTGCAGATCAGCGATGAGAG
GAACAGGGAGCAGGAGGATAAGAACGACAAGTGGCACAGGGTGGAGATGA
GCAGTGACAAGTTCATAAGGAGGTTCAGGCTGCCGGAGAACGCGAAGATT
GATCAGGTGAGGGCGGCGATGGAGAATAGGGTGCTGACTACGTCTTTGCC
GAAAGAGGAGGAGAAGAAGCCCGAGGTCAAGGCCATTGAAATCTCTGGCT
AAACTAAGCTCGCATAAGTTAAACCTCGGCTACTTTTCGGCTTAATGTCG
TGATTAAGTTAAATAATCATGGTTTGCTTTTTGTTGTGGTGTTAGTTACT
GTGTTTTGTATTTCCGAGTTTCTGTGTGTGTGAGACGAGTGTTGTGTGTC
AAACTTAATGTATGGGTTCTTCTATTAAGGATACTTGTGTAAATGAAAGA
GTTAGCATCTTCCCCGAAGAAATATCCTTCACATTGAAGTGAAAGGGATA
AAGATGCATAGAACACCAATTATCAATGAGAAATTGATTCGCATAAAGCA
AATTGTGTTTCAATTCAGGGACATGTAACACATTTCGAAGTTGAAAATTA
TAATGAGCAGTAGGTAATTGAGAAGTGCCAGAGTGAAGAATTGGCAAACC
TTTGCCATCGCCAATATAGACTTGCTTAAGGCCTGTGTAAGAACCTGGAT
TCTGAAAATGACTATACGAATTTGTCATGTGAGTGCTAGCACCAGAGTCC
ACAAGCCAGGTTGGAGAATAAGAAGTTGTACTGGCAACCATTGTAGAAGA
AGAATGAGAAGGAGGACCAGAAAAATGAGGATTCATTCGTTGATGACAAG
CAAAGGCTTCATGACCAAATTGTTTACAAATTTGGCAGGGAATCTTCTTG
CCAGAAGAGGAGAAATTGGAGCGACCACCTCGATTATACCTTTGGTAGCC
TTGTCGATTGGAATTTTGGTGAAAATTGTTAGATCGAAAGTTACCACGAC
CTTGAAAATTTCGAGGATTGGAGACAGAACCTCGAGTTATAGGATTGATG
CGATTTGGTCCACGGCCTTGAGAATTGAAGTCTTGAGCCACCAAAATAGC
TTGAGAAGGCGGCGTAGGAAGAAGAACAGCAGAGGAATTGAAGGCTTGAA
ACGGCGAAGATAGAGATGTTTTCTTCCGATTCATCAATTGAATCTCCTTG
ATGAAAAAAAGGCCATGGAGGTCATCAATTGTCGTGGAACCAAGGCAAAA
TTGAATCGCATCAACAAACGAGTCATATTTAGGTGGAAGTTCATGAAGAA
TGATAGAGATTAACTCGGAATCTTCAATCAGAGCTCCGGCACTTGCAAGA
GCATCAACAATATCTTCAATTTGTTGAAGAAATCGTGCAGCAAAAGAATC
TCCCTTAGTTAGAGTTCGAAGACGAGATTTGAGTTCATGAATATGCGATT
AAGACGCTGTCGTAAGCCGTGATTCCAATTTTGCCCACAGTTCTCGAGAA
GATCTAACTCCAACAGTGTAAGGAATCAAAGAATCAGAAAGTGTATAGTT
GATCCAGATGAGAATGTTCTGATCATTCTTAAACCATGTAACATAGGCCG
GATTCAGAGTGCGAGATCCAGTTGCATCAGTGAGAAATTGAGGCGGTGGA
GGAATCGAGCCATCAACAATGCCTGCAAGATTGTACCGACGAAAAATAAA
AGCGAATAAAGCACTCTAGGTTAAGTAATTCGTCGTGGTCAATTTGATCG
GCACCAGAGATCCAATGTTCTGGATCGTGATGGAAGTAGTATGAGATGCA
CAAAAAGAATTAGGGCTAGAATCAACGAGCGGATGAGGGTGAGAGCTAGA
ATTTGAAGAGGGAGAAGCGACGGTCGCCATGGAAGAGAACAGAAGAAATT
AGGGTTTTAGATGCAAAAAGCTTCAAGAAATGGAAGCTTAGCAACGAAGA
AAATGAAGAGTCGCAGAAAGCGTAGTGACGAAGGAAAGAGGATCGGGTCG
TTAGACAGAGGCGAGTGATACCATATTAGAAAAGAATAACTTTTCATTAC
ATTGATAAAATTACAAGATAGTTGTATATATACAACTCATTTACACAAGT
CACCATCAACCACTCTAACTAACTAATTACACATTTCAACTGATTAACAA
ATATTGAACTATATCTCTAAAGGGTTAACTAACTCTTTCATTTACATAAG
TACCCTTAATATCTTCCTCTAAAATATTATATACCTTTATCAAAATTGCG
TAGATTTTAAATTTGTATTTTTAACCGATCATAAGGACTGCCATACTACT
AAAGAATTTTACACTTCATTTATTTTTTATCAAAATTAAATAAAGAATTC
AAAAAATTTAATAAAACGAGAAGAATGAATCAATGAAATGTTGCTTTATC
TTCTTTGGAAACTTGATTGAAAAATAGTTGTGGTTTTATAGAATTTTAAA
GCGGCAATCCCTTTGTTTTATCTTTCTTTGGTGTAAGCAGGATGAGAGGA
AACTTTCACGTCCGGTTTTGAAACAGAAAAACCCTATATGATCGTATCTA
AATTTTTCTTTTGCTTTGCCCATAATTAAACAATTAAACAATTTATTTTC
TTACAATTACGAGATTCATTCAAAAATATAATTACGAGATTTATTCAAAT
ATGAAATTTAGTCCCGAAAATGCAACACCCACTCCTTTTTTTCACCTCCC
AAGGCCTTCGTATATTTCTTTTCTTTTTTCAGTATTCAAGGCCTACATAC
ATTTCGAAATAGAAAAAATTTCTATCGGAGTAGAGCTATTTGAGAATATT
TATCCGATTTAAATTTGCAAGTTATAATAAATTATTTGTTGGTAGAATGG
AAAGAATTAGGAGAAGCAGCGCCCACAGGTTATGAATGGGAAGATTGAAA
AAATACAAAAAAGACCATTGTGGCCCCTTCATCTCTAGGGTCCGGTTCCC
CACAGATTAAACCAAGAGATCTAAAATCCTTCAGTTAGCTAAGCATTGAA
AAAGACCATTGTGGCTACTTCTAGGAATCCCGGCATAAGCCATCGTGCAT
CTAGTTATACTAGGGCAGCCAAGCTCATCCACGTCTGGATATTCGGAGGG
TAGAGTTTATCCTCCCGTCTTGAAAAGCTGACCTATATGGGTGTCGAGGA
ATTGGTTTACCCTTTCGCACTAGAGAGCAATTAGTTTACCCTATCGCACT
GGAGAGCATGGTTGGTCCCTCGGGGGGCACAATTCCTGCGATGAGTCCCT
AAGAAGAGCACGGTCTTTTTTTGAAGTGCAAAAGTGATCAATTGTTGTGA
GCATGCAGCTGAGCCAAGCTATGATTACTTCTGAATTCCTCATTGAAAAA
CGAGTGAAACGAACAAGAACTTAACTATAAGGTAGGAACTACATAACAAC
TGGATAGTCCTCGGCTTGTGAGGTGGTGCCCGTTAAGCTGCTTGTGTCTT
AGGGCTTTGATGTAGCAGAGGGTCACACATGGTACTTCCTCAGATTGTAG
GCGCTCCACTGCTTTTCGATCTTTTTATCGTTTCATGGTGGCGAAGGTGT
AATTACTCTTGCCGCCTACTCTGCTGATCTTGTATGGACCTTTCCAGATA
GGATCCATCTTTTTGGAGCCTTCTTTGCGGGCAGTGATAAAGACTTTTCT
TAGGACTAGATCTTCAAGCTGGAACTACCGGATCTTGGCCCTTTTGTTGT
AGCTGGAAAAGAACTATTGCTGGTAGGCTGCGATGTATGCGATGGTCTAC
TTGCGCTTTTCATCCGCCAGATCTAAGCTTATGGCTATCTCCTTATTGTT
CTGCTTAATGCTTGGTAGTAGAGCGGTAATACTTAGCTCAATGACATTGC
GATGAATGATTGCTTCTGAGCCAAATTCCAAAAAGAAAGTAGTCTCACCG
GTTGCTCGTCTTTTAGTGGTGCGATATACCTATAGACATCCAGGAAGTTC
GTCTGGCCATTTTCCCTTTTTGTTGGTGAGTGATTTCTTGAGGCAGTCGA
AGATCATCTTGTTGGATGTTTCGGCCCGCCTACTGCCTTGAGGATATCTT
GGCATGGACATGTGTTGCTTGATACCATACTTTTGGAAAAACTTCGCCAC
ATCTTGGCCCACGAATTGTGGGCTGTTGTCGGTGACGATGGACTGAGGTA
TGCCAAATCAGCAAATAATGTTCCTCCATATGAAGTGCTCTATGTCCATA
TGAGTTGCGGTCGTCTTGGGCTCTGCTTCTACCCATTTGGTGTAGTAATC
GATTGCCATGATCATTATGCATCTGCCCCCAGTAGTAGGCGGCATAGGTC
ACACCAGGTCGATTGCCCTCTACATGAACTGCCAGCGATTCGTCTGCAGG
TGTAGCTCGCTAGTAGACAGTGATGGTACCGGCTGGTAGCGTTGGCAACG
GTTGCATTTTTGTACTAACTTTTTAGCATCTCGGTGCATGGTAGGCTAGC
AGTAACCTGCGTTAAGAGCCTTCTGTGCTAAGGATCGACCTCCGGAGTGA
TTTCCACAACTCCTTCATGGATTGAGCTTAAAACCTTCAAGTCATCGGGA
GATGCTAGGCAGCAGAGATGTGGTCTAGTGTAAGATTTTTGGATGTGAAT
GCCGTTCCACATGTAGTAGTGTGCTGCCTTGATTTGGAGCTTCCTATACT
CTAATATTTTCGTGGGGAATGTGCCATTGACCAGGTAGTCTACAATGGAA
TCTTGTCTATTTTGAGTTGTACTAACTTGTCACACCTCGGCTGCTGGCTT
CGCCTCTATGCTTGGCTCGTCTAGATACTCCACCGGAATAGAGCTTTTAA
GTTGATGGTCGAGGGCGGAGCCTAGGCCGACTAATGTGTCCACGTGAAAG
CTGCATGTGGAACTTGAGTGAAGGTGTAAGTCTAAAACGCCTCAAGCAGT
CTGGCTAGTGATTAGCTGGGAATCAAAATAAATTGCGAGCTTTTTCACCG
CCAAGTCTTTTTTCCATTCGGAGGCCTACTAGTACGGTCTCGTATTCTGC
TTCATTGTTGGATACTTTGAAGCCTAGAGTGATTACCTATTTGGGTATCG
AGTGATTGCCTGTTTGGGTATCGAGTGATTGCCTGTTTGGGTATCAAATC
GTCTAGGGTGACAAGGACTAAGCTTGCTCTTGAACCTTTGTAGTTGGATA
TGTCGTCGACATGCAAATGCCAAAAGTCTCCATCGGGTGGAGCAGGCGCG
GCTAAGGCGTGCTCGACTACTTCCAGGGTGTCGTTAGGCCACTCTGTTGC
GTATTGAATGCGTGGTAGAGAGCTGTGGAGCTAGGGCCATGTTGCACACA
TAAGATGCTTAACTGCCAGTATTGGGCCATTCTAGAATTGAATTATGGAG
TGAAGGTCGGCTAGGGCCGTGTGACACGTAGCAGGAAGTGGTGTTCAACT
GCCGATACATGTTGTTCCTATGTATAATCTTTTGGGACGACAAGGACAAA
ACTTGATTCCAAGTGTGTCCTTCCAATGTTCATCTGCCATTGGCGTGTCT
TTTGGGCCGAGTTATTGTGTTCATCAAAATACTTTGTATCTGCCAAAGTC
TACGCCTTTATCGTCGCGCATTTGGATTGGGCAGAATAGTGTGTTATGAG
GATGACTACGTGCATTTGAAGGTAAAACTTGAGCTTCCGGGTTGCAACAA
CTATTGCCAAAGTTAGCTTTTGAATTTTTGATAGCATTGAAGAGAGTTTT
TGAACTATGGAATACAGGTAGTCGGGCCCCCAGCTCTTCTCGCATGATGG
TAGAGCTTATTGCTGCTTTAGATACCGTCAAACATGCAAACAAGTCCTCC
ACTGCTACCAATTTGGATAGTAGAGAGGTGATGTCAGGTACTTCTTCAAG
TCATTGAATGTGCATTGGCGAGACTCGTCCCAAAGTGCATGCTTCTTTGC
CAAAGCCATAGAGTCTGCTAGAGTTAGATCTTCTTTCATGATCAATTTTT
CGAATAACGGGTGATCTGCTGGAAGTCCTTTTTGGAATGTTGTTCTAGCT
ATTGAGTCGTTGCATCCAATTATCCTTGCCTTCTCTGCTTTGAACCTTTT
CATATAGTTGCAAAACGACTTCTTTGGATTTTTCTTGACGTTGAACAAAT
AGTAAGACTTCTTTTTTATTAAGCGATATGATGAATATTCTTTGGTGAAA
ACCAAAGAAGGTTCGTCGAAACTTCAGATGGATTGTGGCTGTAGGGTATA
GAACCAATTTTTCCCCTCGCCTTATAGAGTGGTGGTGAATATCTTGCATA
TGAGATCGTCGTTGTTTCGATAGAAGATCATTACGCTTAGTTAGTGTTTT
AAGTGTCTCTCCGGGTCTTCATCCCCTTTGAAAGATATGAAATGTGGCAT
GCTGAACTCGCATGGAGGCTCTACCTACTCGATCTCGTCCGTGAAGGGTG
ACCTGCTTATGTTGGTCATGTTCCATCGTAGTGCCTCGTCGGTGACCTTG
TTGCGTTGGAAATTGCACAATTGCTTGGTCAAGAATCTTTTTACTTCTTC
TTGAATTTGCCTTTGTTGGGGGTAACGGAGATATCGGCTGCCCCTAGCCA
TGACTTGCTGGTCTAGGCTGCTCTTCCACTTGTTGGCTCGTCTATGCCGC
AGATGAGGTGCGTGTGGTGTGTTCCTAGCAGGCGAGCGAGTTCTTTGTAG
GCTGCCGGTTAAACTTGAGTAGGATTGAGTGACTACTTCTCTCCATCCAT
CGTGCTACATACTCTGATGTGAGGTAGACGATGCTCATTGCGGGCTTAGC
CACGAATGAACACTTCGCCTGGAAGGTTGCTCATGTTGACTATCGGAGTG
TGACCCCAACCATGATTGTATGCTAGTTCGTAAGCCTAGTCAAGAGTGCA
TGATCCTCCACGCGCTAAGACGATAGGGGCTTAATCGGAAGTGTACACTG
CCTGAACTCTCGGTTTGTGGATGGTTGAGTGGCTGCTTACCGGGACACTT
CTATAGAGGTTTTTTGTCTTCCTTTGTCCTACTTCGGAACACCTCATCTG
GGGCATGTTGCATCTCGGTGCACTGCAAAAGTTGGTTCACCAAGGTCATC
TGTTGTGCAAGAGCACTTGTCAACTTTATGACTTGTCAAGACAAGTGTTG
TTCTCTATTTGGGTTAGAATAGCTTGAAAGGAATGCGTCACCTTGAGCAG
TGGAAGTGTGGTGACTCTGGGCATGAGATTTGAGTTGGGAAATATCAAAT
TCGCAGAAAAATGTGATGAAAATGTTCCCGGTTCGATCGTCGGTCCAAAA
ATTTGGAGCCTGGATGATTGAACTAATCTTAGATCGATTTGGGCTGTTTG
GAAGGCCACGGAAATAGACTGGGTGGCGGAAGCAGGCTGGGCCACGAAAG
TGGGCTGCTCGGCGAGAGCAGGCTGAGCCACGAGAGTAGGTTGCTAGGCG
GAAGCAAGCTGGGCCACGAGAGTGGGCTGCTCGGTAGGAGCAAGCTGGGC
CACGGAAGTGGGCTGCTCAGCGTGTGGTGCATGTGGGTGCAAGGCTAAGG
CTCAGCTTGGCAATGCGTTGGGCTCACGTTAGACCTCGTCGCGGGTGGCC
ACCGCGATGGTTCCCGTGGTGGAAACTCATGGTGGTGGTGTTGTTCCACT
TATTGTCACATTTAGCCTTATAGATAGCCGCAATCCCATTTTTTAATATT
GAAAATTTCACTTGTTGAATTTTCTAAATTTCTAGCCATTGTACTTCTCT
TTTATGTTTTATCAAACAATTTTTGCAAATAGAAAATTCTAATAATAAAA
ACGTACGAAAAATCTACAAATGGACAAGAAAATAGAAAAACCTTAGATGC
GAGAGTCTTCTATGAGTGTGGAACTTAGCTCTCAATGAAAGCACCAATTT
GTGGATGCAAATTTCTTCCTCCTTGATCTTGGACAAAATTGCACCTACAA
AACAATTAACACCTTTGGTTAAGGTCAAAAGCTTCACGCGCCCACGATGA
ATGGGGGAGCTTTGGCTGAAGAACCTTCAATGCCAAAATTAGAATTTAGA
GAGAAAGTGTTTGAGAATTTTAGCACGAGAGTTGGAAGTAGTTTTTGGAG
AGAATTGAGAGCTATTTATAGGGATAAGGCCGACCCTATTAGGAGAATAG
GGACTGACCATTTGGGGTATTTTTTTGGTGTAATTTGTGGTTAATTAGCC
ATTAATAGATTAATTAGGTAATAAATCCATTAATTGACTAATTAACATAA
TTTGAAATAATTTGGGAGTTATGGAATATTACCTAATTGATTAGCTAATC
AATATAATAAAAAGGGGAAGATTTGGAGAGGTTCCTTGTGTAGAGGATTG
GATGATGATGGATGAGATAGGTTTTGAATTGTTTACCTATTTTGGGCATT
TTTGACTTGGTTGAGTGATGATTGTCCGCTGCTCGAGCATATGAATCTTG
ATATGCCTCAAGGATAATTTTATCTTTTTATTTAAAAATTCACGTGTCGC
CTTGTGATTATTTTTGGTTCTATATTAATATAATAAGCCTTTTAATAATT
AGGAAGTCTAAGATATAAGGGAGCGTGCTTTTGTTTACTAAAATATTGGC
GGGAGCCAATTTCCTTCCGTCTACCAAAAAAAAAAAAATTCCTTCCCTAC
GCCATTTCAACTAGACAAAAAAGCCTCATCAAATCTTTCTAGTTTATTTT
TCCTAGGCATTAGCCGAAGTCTTTTGGGAGAGAGATTTTTAAATGTGACT
GGTATACAGGGTAGTACATCAAATGTTATTAAATAAATTGTGAGATATGT
GTGCTAAAAAGTTAATAACTTAAAAACTAAAATTTCCCACCATTCTCATT
AAAACACTTGGTATACCACTTATATTTCCATCACAATTAAAAATTTCTCC
TTCTGAGGGGAGTTTTGCCTACGTGGCACACAAATTGGACTTGTCTTAAC
ATTTCTAGGCAAAAACTCATAATTTCGTCGTTTACACATCTCTGCTTAAC
TTTATGATTTTATTYYTTTTTTTTTTTTAATTCAAATGCTAGAAATGTCT
AAACTGTGTAAGAAGAGGAGAACGCAAGGTCTTTAGTGACCTATTCTTGT
GAGTCATCCTCACTAATCCAACGAAATGGGAGATTGGCCGAAGGGAAGAG
AAGGATAAGCAGGGGCTTGAGGAATAATGCGTATACTGCTAATTATTGTG
AAGCTTAATCAACTCTTTCATTTTCATCTGCATGAACAATATGTATAATT
GAGCAATACATGCAATATATAAAACAAGAAAAAATTTGGAGTTCATGCAT
AATTGGTGAATGTTTACATGATGTCAGGACATCAAATATCAGTTCCATGT
TTTAAAATAGGGAGTTTTAACGAAACACTACCTGGTACTGTTCATTTTAA
GAAAACTATATTTTTCTATTCTTTACTATTCACTACACTTTTATTTAGTC
TATTTTTCTACTTTAAAAATTAAAAGTTTTTTTTAAGACTTTAAAAAGTA
CTTTTTCTAAATATTAAGTT
back to top