Hi02f12, Hi02f12 (genetic_marker) Malus x domestica

Marker Overview
NameHi02f12
AliasHi02f12_M
Hi02f12_GaDR
Hi02f12_G
Genbank IDN/A
TypeSSR
SpeciesMalus x domestica
Repeat MotifGA
PCR Conditionannealing temp 60 degree
Primer 1Hi02f12.forward: ACATGGCCGAAGACAATGAC
Primer 2Hi02f12.primer 1: ACATGGCCGAAGACAATGAC
Primer 3Hi02f12.primer 2: GTTTCAACCTTTATCCCTCCATCTTTC
Primer 4Hi02f12.reverse: GTTTCAACCTTTATCCCTCCATCTTTC
Product Length130-150
PolymorphismP_ Hi02f12
Publication[view all]
ContactA. Patocchi
Miyuki Kunihisa
Riccardo Velasco
Contact
NameDetails
A. Patocchi
First name:Andrea
Last name:Patocchi
Institution:Agroscope Changins-W?denswil Research Station ACW
Address:Standort W?denswil Schloss Postfach 185 8820 W?denswil
Country:SWITZERLAND
Email:andrea.patocchi@acw.admin.ch
Phone:+41 44 783 6313
Fax:+41 (0)44 783 63 05
Miyuki Kunihisa
First name:Miyuki
Last name:Kunihisa
Institution:NARO Institute of Fruit Tree Science
Address:2-1 Fujimoto, Tsukuba, Ibaraki 305-8605
Country:Japan
Email:miyuky@affrc.go.jp
Phone:81-29-838-6437
Keywords:fruit drop
Riccardo Velasco
First name:Riccardo
Last name:Velasco
Title:researcher
Institution:IASMA Research and Innovation Centre
Address:Foundation Edmund Mach, Via E. Mach 1, 38010 San Michele all’Adige, Trento, Italy
Country:Italy
Email:riccardo.velasco@iasma.it
Keywords:Venturia inaequalis
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
primer 1Hi02f12.primer 1Malus x domesticaprimer
primer 2Hi02f12.primer 2Malus x domesticaprimer
forwardHi02f12.forwardMalus x domesticaprimer
reverseHi02f12.reverseMalus x domesticaprimer


This genetic_marker is adjacent to the following QTL feature(s):

Feature NameUnique NameSpeciesType
stomatal conductanceqST.STKxGS-ch17Malus x domesticaQTL
transpiration rateqTRPR.STKxGS-ch17Malus x domesticaQTL
catechin contentqCAT.X5210X8402-LG17.J10Malus x domesticaQTL
phenolic compound contentqPHE.X5210X8402-LG17.F09.procyanidinB1Malus x domesticaQTL
phenolic compound contentqPHE.X5210X8402-LG17.F08.5CaffeoylquinicAcid.1Malus x domesticaQTL
phenolic compound contentqPHE.X5210X8402-LG17.F08.5CaffeoylquinicAcid.2Malus x domesticaQTL
phenolic compound contentqPHE.X5210X8402-LG17.F09.5CaffeoylquinicAcid.1Malus x domesticaQTL
phenolic compound contentqPHE.X5210X8402-LG17.F09.5CaffeoylquinicAcid.2Malus x domesticaQTL
phenolic compound contentqPHE.X5210X8402-LG17.J09.5CaffeoylquinicAcid.1Malus x domesticaQTL
phenolic compound contentqPHE.X5210X8402-LG17.J09.5CaffeoylquinicAcid.2Malus x domesticaQTL
phenolic compound contentqPHE.X5210X8402-LG1.J17.5CaffeoylquinicAcidMalus x domesticaQTL
phenolic compound contentqPHE.X5210X8402-LG1.J10.5CaffeoylquinicAcidMalus x domesticaQTL
p-coumaroyl quinic acid contentqCQA.X5210X8402-LG17.J10.5pMalus x domesticaQTL
phenolic compound contentqPHE.X5210X8402-LG7.F09.isoquercitrinMalus x domesticaQTL


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
Hi02f12Hi02f12Malus x domesticamarker_locus


Publications
YearPublication
2009Celton J-M, Tustin DS, Chagne D, Gardiner SE. Construction of a dense genetic linkage map for apple rootstocks using SSRs developed from Malus ESTs and Pyrus genomic sequences. Tree Genetics and Genomes. 2009; 5(1):93-107.
2010Velasco R, Zharkikh A, Affourtit J, Dhingra A, Cestaro A, Kalyanaraman A, Fontana P, Bhatnagar SK, Troggio M, Pruss D, Salvi S, Pindo M, Baldi P, Castelletti S, Cavaiuolo M, Coppola G, Costa F, Cova V, Dal Ri A, Goremykin V, Komjanc M, Longhi S, Magnago P, Malacarne G, Malnoy M, Micheletti D, Moretto M, Perazzolli M, Si-Ammour A, Vezzulli S, Zini E, Eldredge G, Fitzgerald LM, Gutin N, Lanchbury J, Macalma T, Mitchell JT, Reid J, Wardell B, Kodira C, Chen Z, Desany B, Niazi F, Palmer M, Koepke T, Jiwan D, Schaeffer S, Krishnan V, Wu C, Chu VT, King ST, Vick J, Tao Q, Mraz A, Stormo A, Stormo K, Bogden R, Ederle D, Stella A, Vecchietti A, Kater MM, Masiero S, Lasserre P, Lespinasse Y, Allan AC, Bus V, Chagné D, Crowhurst RN, Gleave AP, Lavezzo E, Fawcett JA, Proost S, Rouzé P, Sterck L, Toppo S, Lazzari B, Hellens RP, Durel CE, Gutin A, Bumgarner RE, Gardiner SE, Skolnick M, Egholm M, Van de Peer Y, Salamini F, Viola R. The genome of the domesticated apple (Malus x domestica Borkh.). Nature Genetics. 2010 Oct; 42(10):833-839.
2006Silfverberg-Dilworth E, Matasci CL, Van de Weg WE, Van Kaauwen MPW, Walser M, Kodde LP, Soglio V, Gianfranceschi L, Durel CE, Costa F, Yamamoto T, Koller B, Gessler C Patocchi A. Microsatellite markers spanning the apple (Malus x domestica Borkh.) genome. Tree Genetics and Genomes. 2006; 2(4):202-224.
2014Kunihisa M, Moriya S, Abe K, Okada K, Haji T, Hayashi T, Kim H, Nishitani C, Terakami S, Yamamoto T. Identification of QTLs for fruit quality traits in Japanese apples: QTLs for early ripening are tightly related to preharvest fruit drop. Breeding science. 2014 Sep; 64(3):240-51.
2015Cova V, Bandara NL, Liang W, Tartarini S, Patocchi A, Troggio M, Velasco R, Komjanc M. Fine mapping of the Rvi5 (Vm) apple scab resistance locus in the ‘Murray’ apple genotype. Molecular Breeding. 2015. 35: 200.
2015Ben Sadok I, Tiecher A, Galvez-Lopez D, Lahaye M, Lasserre-Zuber P, Bruneau M, Hanteville S, Robic R, Cournol R, Laurens F. Apple fruit texture QTLs: year and cold storage effects on sensory and instrumental traits. Tree Genetics & Genomes 2015 11:119
2002Liebhard, R., Gianfranceschi, L., Koller, B., Ryder, C.D., Tarchini, R., Weg, E. van de., Gessler, C. Development and characterisation of 140 new microsatellites in apple (Malus x domestica Borkh.) Mol. breed. 2002. v. 10 (4) p. 217-241.
2004Plant Breeding, 123(4):321
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Apple-C16xC17-F1-201217N/A64.47Hi02f12View
2Apple-GaxDR-F1LG17N/A40.3Hi02f12View
3Apple-STKxGS-F117N/A40.5Hi02f12View
4Apple-FD-F1-2006F17N/A43.7Hi02f12View
5Apple Integrated map17N/A52.6Hi02f12View
6Apple-OA-F1-OrinOR17N/A52Hi02f12View
7Apple-OA-F1-AkaneAK17-1N/A40.9Hi02f12View
8Apple-GDxM-F1LG17N/A10.6Hi02f12View
9Apple-X3259X3263-F117N/A52.97Hi02f12View
10Apple-RGTxGD-F1-2015RGT_17N/A34.14Hi02f12View
11Apple-X5210X8402-F1-ConsensusLG17N/A43.9Hi02f12View
12Apple-X5210X8402-F1-X5210LG17N/A40Hi02f12View
13Apple-X5210X8402-F1-X8402LG17N/A40Hi02f12View