Hi03d06, Hi03d06 (genetic_marker) Malus x domestica

Marker Overview
NameHi03d06
AliasHi03d06_FM
Hi03d06
Genbank IDN/A
TypeSSR
SpeciesMalus x domestica
Repeat MotifGA
PCR Conditionannealing temp 60 degree
Primer 1Hi03d06.primer 1: TCATGGATCATTTCGGCTAA
Primer 2Hi03d06.primer 2: GTTTGCCAATTTTATCCAGGTTGC
Product Length115-169
PolymorphismP_ Hi03d06
Publication[view all]
ContactA. Patocchi
Andreas Peil
Miyuki Kunihisa
Contact
NameDetails
A. Patocchi
First name:Andrea
Last name:Patocchi
Institution:Agroscope Changins-W?denswil Research Station ACW
Address:Standort W?denswil Schloss Postfach 185 8820 W?denswil
Country:SWITZERLAND
Email:andrea.patocchi@acw.admin.ch
Phone:+41 44 783 6313
Fax:+41 (0)44 783 63 05
Andreas Peil
First name:Andreas
Last name:Peil
Title:Researcher
Institution:Institute for Breeding Research on Fruit
Address:Kulius Kuhn-Institut (JKI), Pillnitzer Platz 3a, 01326
Country:Dresden, Germany
Email:andreas.peil@jki.bund.de
Miyuki Kunihisa
First name:Miyuki
Last name:Kunihisa
Institution:NARO Institute of Fruit Tree Science
Address:2-1 Fujimoto, Tsukuba, Ibaraki 305-8605
Country:Japan
Email:miyuky@affrc.go.jp
Phone:81-29-838-6437
Keywords:fruit drop
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
primer 1Hi03d06.primer 1Malus x domesticaprimer
primer 2Hi03d06.primer 2Malus x domesticaprimer


This genetic_marker is adjacent to the following QTL feature(s):

Feature NameUnique NameSpeciesType
procyanidin B2 contentqPCB.X5210X8402-LG3.J09Malus x domesticaQTL
phenolic compound contentqPHE.X5210X8402-LG3.J09.procyanidinB5Malus x domesticaQTL
phenolic compound contentqPHE.X5210X8402-LG3.J09.procyanidinC1Malus x domesticaQTL
phenolic compound contentqPHE.X5210X8402-LG3.J10.procyanidinCaMalus x domesticaQTL


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
Hi03d06Hi03d06-20.1Malus x domesticamarker_locus
Hi03d06Hi03d06-20.3Malus x domesticamarker_locus
Hi03d06Hi03d06-11.35Malus x domesticamarker_locus
Hi03d06Hi03d06Malus x domesticamarker_locus


Publications
YearPublication
2010Velasco R, Zharkikh A, Affourtit J, Dhingra A, Cestaro A, Kalyanaraman A, Fontana P, Bhatnagar SK, Troggio M, Pruss D, Salvi S, Pindo M, Baldi P, Castelletti S, Cavaiuolo M, Coppola G, Costa F, Cova V, Dal Ri A, Goremykin V, Komjanc M, Longhi S, Magnago P, Malacarne G, Malnoy M, Micheletti D, Moretto M, Perazzolli M, Si-Ammour A, Vezzulli S, Zini E, Eldredge G, Fitzgerald LM, Gutin N, Lanchbury J, Macalma T, Mitchell JT, Reid J, Wardell B, Kodira C, Chen Z, Desany B, Niazi F, Palmer M, Koepke T, Jiwan D, Schaeffer S, Krishnan V, Wu C, Chu VT, King ST, Vick J, Tao Q, Mraz A, Stormo A, Stormo K, Bogden R, Ederle D, Stella A, Vecchietti A, Kater MM, Masiero S, Lasserre P, Lespinasse Y, Allan AC, Bus V, Chagné D, Crowhurst RN, Gleave AP, Lavezzo E, Fawcett JA, Proost S, Rouzé P, Sterck L, Toppo S, Lazzari B, Hellens RP, Durel CE, Gutin A, Bumgarner RE, Gardiner SE, Skolnick M, Egholm M, Van de Peer Y, Salamini F, Viola R. The genome of the domesticated apple (Malus x domestica Borkh.). Nature Genetics. 2010 Oct; 42(10):833-839.
2006Silfverberg-Dilworth E, Matasci CL, Van de Weg WE, Van Kaauwen MPW, Walser M, Kodde LP, Soglio V, Gianfranceschi L, Durel CE, Costa F, Yamamoto T, Koller B, Gessler C Patocchi A. Microsatellite markers spanning the apple (Malus x domestica Borkh.) genome. Tree Genetics and Genomes. 2006; 2(4):202-224.
2014Wöhner TW, Flachowsky H, Richter K, Garcia-Libreros T, Trognitz F, Hanke M, Peil A. QTL mapping of fire blight resistance in Malus ×robusta 5 after inoculation with different strains of Erwinia amylovora. Molecular breeding. 2014; 34(1):217-230.
2014Emeriewen O, Richter K, Kilian A, Zini E, Hanke M, Malnoy M, Peil A. Identification of a major quantitative trait locus for resistance to fire blight in the wild apple species Malus fusca. Molecular breeding. 2014; 34(2):407-419.
2012Antanaviciute L, Fernández-Fernández F, Jansen J, Banchi E, Evans KM, Viola R, Velasco R, Dunwell JM, Troggio M, Sargent DJ. Development of a dense SNP-based linkage map of an apple rootstock progeny using the Malus Infinium whole genome genotyping array. BMC genomics. 2012; 13:203.
2014Kunihisa M, Moriya S, Abe K, Okada K, Haji T, Hayashi T, Kim H, Nishitani C, Terakami S, Yamamoto T. Identification of QTLs for fruit quality traits in Japanese apples: QTLs for early ripening are tightly related to preharvest fruit drop. Breeding science. 2014 Sep; 64(3):240-51.
2015Ben Sadok I, Tiecher A, Galvez-Lopez D, Lahaye M, Lasserre-Zuber P, Bruneau M, Hanteville S, Robic R, Cournol R, Laurens F. Apple fruit texture QTLs: year and cold storage effects on sensory and instrumental traits. Tree Genetics & Genomes 2015 11:119
2002Liebhard, R., Gianfranceschi, L., Koller, B., Ryder, C.D., Tarchini, R., Weg, E. van de., Gessler, C. Development and characterisation of 140 new microsatellites in apple (Malus x domestica Borkh.) Mol. breed. 2002. v. 10 (4) p. 217-241.
2004Plant Breeding, 123(4):321
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Apple-JM7xS63-F1S3N/A20.1Hi03d06-20.1View
2Apple-JM7xS63-F1J3N/A20.3Hi03d06-20.3View
3Apple-Coop17xCoop16-F1-2014LG03N/A11.35Hi03d06-11.35View
4Apple-C16xC17-F1-20123N/A30.4Hi03d06View
5Apple-FD-F1-2006D3aN/A43.3Hi03d06View
6Apple Integrated map3N/A30.9Hi03d06View
7Apple-IM-F1-IdaredIda LG 3N/A34.9Hi03d06View
8Apple-IM-F1-Mr5Mr5 LG 3N/A24.1Hi03d06View
9Apple-MAL0045_x_Idared-F1-MfuscaLG3N/A22.6Hi03d06View
10Apple-MM-F13N/A26.8Hi03d06View
11Apple-OA-F1-OrinOR3N/A14.4Hi03d06View
12Apple-OA-F1-AkaneAK3N/A33.5Hi03d06View
13Apple-X3259X3263-F13N/A26.8Hi03d06View
14Apple-M432-2012LG3N/A30.8Hi03d06View
15Apple-IxR5-F1-2008LG3N/A22Hi03d06View
16Apple-M9xR5-F1-2008LG3N/A29Hi03d06View
17Apple-RGTxGD-F1-2015RGT_3N/A20.01Hi03d06View
18Apple-RGTxGD-F1-2015GD_3N/A21.48Hi03d06View
19Apple-RGxPI6-F1LG3N/A22.8Hi03d06View
20Apple-X5210X8402-F1-ConsensusLG3N/A32.6Hi03d06View
21Apple-X5210X8402-F1-X5210LG3N/A24.1Hi03d06View
22Apple-X5210X8402-F1-X8402LG3N/A48.8Hi03d06View