Hi03g06, Hi03g06 (genetic_marker) Malus x domestica

Marker Overview
NameHi03g06
AliasHi03g06_FM
Genbank IDN/A
TypeSSR
SpeciesMalus x domestica
Repeat MotifGA
PCR Conditionannealing temp 60 degree
Primer 1Hi03g06.primer 1: TGCCAATACTCCCTCATTTACC
Primer 2Hi03g06.primer 2: GTTTAAACAGAACTGCACCACATCC
Product Length182-204
PolymorphismP_ Hi03g06
Publication[view all]
ContactA. Patocchi
Miyuki Kunihisa
Contact
NameDetails
A. Patocchi
First name:Andrea
Last name:Patocchi
Institution:Agroscope Changins-W?denswil Research Station ACW
Address:Standort W?denswil Schloss Postfach 185 8820 W?denswil
Country:SWITZERLAND
Email:andrea.patocchi@acw.admin.ch
Phone:+41 44 783 6313
Fax:+41 (0)44 783 63 05
Miyuki Kunihisa
First name:Miyuki
Last name:Kunihisa
Institution:NARO Institute of Fruit Tree Science
Address:2-1 Fujimoto, Tsukuba, Ibaraki 305-8605
Country:Japan
Email:miyuky@affrc.go.jp
Phone:81-29-838-6437
Keywords:fruit drop
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
primer 1Hi03g06.primer 1Malus x domesticaprimer
primer 2Hi03g06.primer 2Malus x domesticaprimer


This genetic_marker is adjacent to the following QTL feature(s):

Feature NameUnique NameSpeciesType
epicatechin contentqECAT.X5210X8402-LG15.J10Malus x domesticaQTL
phenolic compound contentqPHE.X5210X8402-LG15.J10.procyanidinCd.1Malus x domesticaQTL
phenolic compound contentqPHE.X5210X8402-LG15.J10.procyanidinGMalus x domesticaQTL
phenolic compound contentqPHE.X5210X8402-LG15.J10.unknownFlavanol518Malus x domesticaQTL


This genetic_marker is located in the following QTL feature(s):

Feature NameUnique NameSpeciesType
fruit textureqFT.XX-ch15.1Malus x domesticaQTL


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
Hi03g06Hi03g06-188.99Malus x domesticamarker_locus
Hi03g06Hi03g06-81.227Malus x domesticamarker_locus
Hi03g06Hi03g06-77.685Malus x domesticamarker_locus
Hi03g06Hi03g06-76.8Malus x domesticamarker_locus
Hi03g06Hi03g06Malus x domesticamarker_locus


Publications
YearPublication
2010Velasco R, Zharkikh A, Affourtit J, Dhingra A, Cestaro A, Kalyanaraman A, Fontana P, Bhatnagar SK, Troggio M, Pruss D, Salvi S, Pindo M, Baldi P, Castelletti S, Cavaiuolo M, Coppola G, Costa F, Cova V, Dal Ri A, Goremykin V, Komjanc M, Longhi S, Magnago P, Malacarne G, Malnoy M, Micheletti D, Moretto M, Perazzolli M, Si-Ammour A, Vezzulli S, Zini E, Eldredge G, Fitzgerald LM, Gutin N, Lanchbury J, Macalma T, Mitchell JT, Reid J, Wardell B, Kodira C, Chen Z, Desany B, Niazi F, Palmer M, Koepke T, Jiwan D, Schaeffer S, Krishnan V, Wu C, Chu VT, King ST, Vick J, Tao Q, Mraz A, Stormo A, Stormo K, Bogden R, Ederle D, Stella A, Vecchietti A, Kater MM, Masiero S, Lasserre P, Lespinasse Y, Allan AC, Bus V, Chagné D, Crowhurst RN, Gleave AP, Lavezzo E, Fawcett JA, Proost S, Rouzé P, Sterck L, Toppo S, Lazzari B, Hellens RP, Durel CE, Gutin A, Bumgarner RE, Gardiner SE, Skolnick M, Egholm M, Van de Peer Y, Salamini F, Viola R. The genome of the domesticated apple (Malus x domestica Borkh.). Nature Genetics. 2010 Oct; 42(10):833-839.
2006Silfverberg-Dilworth E, Matasci CL, Van de Weg WE, Van Kaauwen MPW, Walser M, Kodde LP, Soglio V, Gianfranceschi L, Durel CE, Costa F, Yamamoto T, Koller B, Gessler C Patocchi A. Microsatellite markers spanning the apple (Malus x domestica Borkh.) genome. Tree Genetics and Genomes. 2006; 2(4):202-224.
2012Schouten HJ, van de Weg WE, Carling J, Khan SI, McKay SJ, van Kaauwen MPW, Wittenberg AHJ, Koehorst-van Putten HJJ, Noordijk Y, Gao Z, Rees DJG, Van Dyk MM, Jaccoud D, Considine MJ, Kilian A. Diversity arrays technology (DArT) markers in apple for genetic linkage maps. Molecular breeding 2012 29:645–660
2014Kunihisa M, Moriya S, Abe K, Okada K, Haji T, Hayashi T, Kim H, Nishitani C, Terakami S, Yamamoto T. Identification of QTLs for fruit quality traits in Japanese apples: QTLs for early ripening are tightly related to preharvest fruit drop. Breeding science. 2014 Sep; 64(3):240-51.
2015Ben Sadok I, Tiecher A, Galvez-Lopez D, Lahaye M, Lasserre-Zuber P, Bruneau M, Hanteville S, Robic R, Cournol R, Laurens F. Apple fruit texture QTLs: year and cold storage effects on sensory and instrumental traits. Tree Genetics & Genomes 2015 11:119
2002Liebhard, R., Gianfranceschi, L., Koller, B., Ryder, C.D., Tarchini, R., Weg, E. van de., Gessler, C. Development and characterisation of 140 new microsatellites in apple (Malus x domestica Borkh.) Mol. breed. 2002. v. 10 (4) p. 217-241.
2004Plant Breeding, 123(4):321
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Pear-integrated_consensus_map-IPCG-2017LG15N/A188.99Hi03g06-188.99View
2Pear-Dangshansuli-F1-2015LG15N/A81.23Hi03g06-81.227View
3Pear-Bayuehong-F1-2015LG15N/A77.69Hi03g06-77.685View
4Pear-BD-F1-2015LG15N/A76.8Hi03g06-76.8View
5Apple-C16xC17-F1-201215N/A32.98Hi03g06View
6Apple-FD-F1-2006F15N/A15.5Hi03g06View
7Apple-FD-F1-2006D15N/A22.6Hi03g06View
8Apple Integrated map15N/A22Hi03g06View
9Apple-PF-F1-2012ch15N/A11Hi03g06View
10Apple-OA-F1-OrinOR15N/A16.4Hi03g06View
11Apple-OA-F1-AkaneAK15N/A24.7Hi03g06View
12Apple-X3259X3263-F115N/A23.05Hi03g06View
13Apple-RGTxGD-F1-2015RGT_15N/A35.38Hi03g06View
14Apple-RGTxGD-F1-2015GD_15N/A20.62Hi03g06View
15Apple-X5210X8402-F1-ConsensusLG15N/A9.3Hi03g06View
16Apple-X5210X8402-F1-X5210LG15N/A10Hi03g06View