|
Marker Overview
Name | CH03d11 |
Alias | CH03d11_FM CH03d11
|
Genbank ID | N/A |
Type | SSR |
Species | Malus x domestica |
Repeat Motif | GA |
PCR Condition | annealing temp 60 degree |
Primer 1 | CH03d11.primer 1: ACCCCACAGAAACCTTCTCC |
Primer 2 | CH03d11.primer 2: CAACTGCAAGAATCGCAGAG |
Product Length | 115-181 |
Polymorphism | P_ CH03d11 |
Publication | [view all] |
Contact | C. Gessler Andreas Peil
|
Relationships
This genetic_marker is adjacent to the following primer feature(s):
The following marker_locus feature(s) are an instance of this genetic_marker:
Publications
Year | Publication |
2004 | Yamamoto T, Kimura T, Saito T, Kotobuki K, Matsuta N, Liebhard R, Gessler C, Weg W.E. van de, Hayashi, T. Genetic linkage maps of Japanese and European pears aligned to the apple consensus map. Acta Horticulturae. 2004; 663:51-56. |
2006 | Silfverberg-Dilworth E, Matasci CL, Van de Weg WE, Van Kaauwen MPW, Walser M, Kodde LP, Soglio V, Gianfranceschi L, Durel CE, Costa F, Yamamoto T, Koller B, Gessler C Patocchi A. Microsatellite markers spanning the apple (Malus x domestica Borkh.) genome. Tree Genetics and Genomes. 2006; 2(4):202-224. |
2010 | Velasco R, Zharkikh A, Affourtit J, Dhingra A, Cestaro A, Kalyanaraman A, Fontana P, Bhatnagar SK, Troggio M, Pruss D, Salvi S, Pindo M, Baldi P, Castelletti S, Cavaiuolo M, Coppola G, Costa F, Cova V, Dal Ri A, Goremykin V, Komjanc M, Longhi S, Magnago P, Malacarne G, Malnoy M, Micheletti D, Moretto M, Perazzolli M, Si-Ammour A, Vezzulli S, Zini E, Eldredge G, Fitzgerald LM, Gutin N, Lanchbury J, Macalma T, Mitchell JT, Reid J, Wardell B, Kodira C, Chen Z, Desany B, Niazi F, Palmer M, Koepke T, Jiwan D, Schaeffer S, Krishnan V, Wu C, Chu VT, King ST, Vick J, Tao Q, Mraz A, Stormo A, Stormo K, Bogden R, Ederle D, Stella A, Vecchietti A, Kater MM, Masiero S, Lasserre P, Lespinasse Y, Allan AC, Bus V, Chagné D, Crowhurst RN, Gleave AP, Lavezzo E, Fawcett JA, Proost S, Rouzé P, Sterck L, Toppo S, Lazzari B, Hellens RP, Durel CE, Gutin A, Bumgarner RE, Gardiner SE, Skolnick M, Egholm M, Van de Peer Y, Salamini F, Viola R. The genome of the domesticated apple (Malus x domestica Borkh.). Nature Genetics. 2010 Oct; 42(10):833-839. |
2002 | Liebhard, R., Gianfranceschi, L., Koller, B., Ryder, C.D., Tarchini, R., Weg, E. van de., Gessler, C. Development and characterisation of 140 new microsatellites in apple (Malus x domestica Borkh.) Mol. breed. 2002. v. 10 (4) p. 217-241. |
2014 | Wöhner TW, Flachowsky H, Richter K, Garcia-Libreros T, Trognitz F, Hanke M, Peil A. QTL mapping of fire blight resistance in Malus ×robusta 5 after inoculation with different strains of Erwinia amylovora. Molecular breeding. 2014; 34(1):217-230. |
2014 | Emeriewen O, Richter K, Kilian A, Zini E, Hanke M, Malnoy M, Peil A. Identification of a major quantitative trait locus for resistance to fire blight in the wild apple species Malus fusca. Molecular breeding. 2014; 34(2):407-419. |
2012 | Schouten HJ, van de Weg WE, Carling J, Khan SI, McKay SJ, van Kaauwen MPW, Wittenberg AHJ, Koehorst-van Putten HJJ, Noordijk Y, Gao Z, Rees DJG, Van Dyk MM, Jaccoud D, Considine MJ, Kilian A. Diversity arrays technology (DArT) markers in apple for genetic linkage maps. Molecular breeding 2012 29:645–660 |
2012 | Antanaviciute L, Fernández-Fernández F, Jansen J, Banchi E, Evans KM, Viola R, Velasco R, Dunwell JM, Troggio M, Sargent DJ. Development of a dense SNP-based linkage map of an apple rootstock progeny using the Malus Infinium whole genome genotyping array. BMC genomics. 2012; 13:203. |
2015 | Ben Sadok I, Tiecher A, Galvez-Lopez D, Lahaye M, Lasserre-Zuber P, Bruneau M, Hanteville S, Robic R, Cournol R, Laurens F. Apple fruit texture QTLs: year and cold storage effects on sensory and instrumental traits. Tree Genetics & Genomes 2015 11:119 |
2004 | Plant Breeding, 123(4):321 |
|