CH04e05, CH04e05 (genetic_marker) Malus x domestica

Marker Overview
NameCH04e05
AliasCH04e05
Genbank IDN/A
TypeSSR
SpeciesMalus x domestica
Repeat MotifGA
PCR Conditionannealing temp 60 degree
Primer 1CH04e05.primer 1: AGGCTAACAGAAATGTGGTTTG
Primer 2CH04e05.primer 2: ATGGCTCCTATTGCCATCAT
Product Length174-227
174–227
Max Length204 bp
PolymorphismP_ CH04e05
Publication[view all]
ContactC. Gessler
Andreas Peil
Contact
NameDetails
C. Gessler
First name:Cesare
Last name:Gessler
Institution:ETH Zurich
Address:ZTH Zurich Institut f. Integrative Biologie LFW C 15 Universitatstrasse 2 8092 Zurich
Country:Switzerland
Email:cesare.gessler@agrl.ethz.ch
Phone:+41 44 632 38 71
Fax:+41 (0) 632 11 08
Last update:May 2002
Andreas Peil
First name:Andreas
Last name:Peil
Title:Researcher
Institution:Institute for Breeding Research on Fruit
Address:Kulius Kuhn-Institut (JKI), Pillnitzer Platz 3a, 01326
Country:Dresden, Germany
Email:andreas.peil@jki.bund.de
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
primer 1CH04e05.primer 1Malus x domesticaprimer
primer 2CH04e05.primer 2Malus x domesticaprimer


This genetic_marker is adjacent to the following QTL feature(s):

Feature NameUnique NameSpeciesType
stem lengthqSTL.FD-ch7.Ticino year1Malus x domesticaQTL


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
CH04e05CH04e05-15.7Malus x domesticamarker_locus
CH04e05CH04e05-17Malus x domesticamarker_locus
CH04e05CH04e05-75.022Malus x domesticamarker_locus
CH04e05CH04e05-84.129Malus x domesticamarker_locus
CH04e05CH04e05-43.199Malus x domesticamarker_locus
CH04e05CH04e05-33.91Malus x domesticamarker_locus
CH04e05CH04e05-36.786Malus x domesticamarker_locus
CH04e05CH04e05-37.936Malus x domesticamarker_locus
CH04e05CH04e05-37.9Malus x domesticamarker_locus
CH04e05CH04e05-22.3Malus x domesticamarker_locus
CH04e05CH04e05Malus x domesticamarker_locus


Publications
YearPublication
2004Yamamoto T, Kimura T, Saito T, Kotobuki K, Matsuta N, Liebhard R, Gessler C, Weg W.E. van de, Hayashi, T. Genetic linkage maps of Japanese and European pears aligned to the apple consensus map. Acta Horticulturae. 2004; 663:51-56.
2009Celton J-M, Tustin DS, Chagne D, Gardiner SE. Construction of a dense genetic linkage map for apple rootstocks using SSRs developed from Malus ESTs and Pyrus genomic sequences. Tree Genetics and Genomes. 2009; 5(1):93-107.
2006Silfverberg-Dilworth E, Matasci CL, Van de Weg WE, Van Kaauwen MPW, Walser M, Kodde LP, Soglio V, Gianfranceschi L, Durel CE, Costa F, Yamamoto T, Koller B, Gessler C Patocchi A. Microsatellite markers spanning the apple (Malus x domestica Borkh.) genome. Tree Genetics and Genomes. 2006; 2(4):202-224.
2010Velasco R, Zharkikh A, Affourtit J, Dhingra A, Cestaro A, Kalyanaraman A, Fontana P, Bhatnagar SK, Troggio M, Pruss D, Salvi S, Pindo M, Baldi P, Castelletti S, Cavaiuolo M, Coppola G, Costa F, Cova V, Dal Ri A, Goremykin V, Komjanc M, Longhi S, Magnago P, Malacarne G, Malnoy M, Micheletti D, Moretto M, Perazzolli M, Si-Ammour A, Vezzulli S, Zini E, Eldredge G, Fitzgerald LM, Gutin N, Lanchbury J, Macalma T, Mitchell JT, Reid J, Wardell B, Kodira C, Chen Z, Desany B, Niazi F, Palmer M, Koepke T, Jiwan D, Schaeffer S, Krishnan V, Wu C, Chu VT, King ST, Vick J, Tao Q, Mraz A, Stormo A, Stormo K, Bogden R, Ederle D, Stella A, Vecchietti A, Kater MM, Masiero S, Lasserre P, Lespinasse Y, Allan AC, Bus V, Chagné D, Crowhurst RN, Gleave AP, Lavezzo E, Fawcett JA, Proost S, Rouzé P, Sterck L, Toppo S, Lazzari B, Hellens RP, Durel CE, Gutin A, Bumgarner RE, Gardiner SE, Skolnick M, Egholm M, Van de Peer Y, Salamini F, Viola R. The genome of the domesticated apple (Malus x domestica Borkh.). Nature Genetics. 2010 Oct; 42(10):833-839.
2002Liebhard, R., Gianfranceschi, L., Koller, B., Ryder, C.D., Tarchini, R., Weg, E. van de., Gessler, C. Development and characterisation of 140 new microsatellites in apple (Malus x domestica Borkh.) Mol. breed. 2002. v. 10 (4) p. 217-241.
2014Wöhner TW, Flachowsky H, Richter K, Garcia-Libreros T, Trognitz F, Hanke M, Peil A. QTL mapping of fire blight resistance in Malus ×robusta 5 after inoculation with different strains of Erwinia amylovora. Molecular breeding. 2014; 34(1):217-230.
2014Emeriewen O, Richter K, Kilian A, Zini E, Hanke M, Malnoy M, Peil A. Identification of a major quantitative trait locus for resistance to fire blight in the wild apple species Malus fusca. Molecular breeding. 2014; 34(2):407-419.
2012Schouten HJ, van de Weg WE, Carling J, Khan SI, McKay SJ, van Kaauwen MPW, Wittenberg AHJ, Koehorst-van Putten HJJ, Noordijk Y, Gao Z, Rees DJG, Van Dyk MM, Jaccoud D, Considine MJ, Kilian A. Diversity arrays technology (DArT) markers in apple for genetic linkage maps. Molecular breeding 2012 29:645–660
2012Antanaviciute L, Fernández-Fernández F, Jansen J, Banchi E, Evans KM, Viola R, Velasco R, Dunwell JM, Troggio M, Sargent DJ. Development of a dense SNP-based linkage map of an apple rootstock progeny using the Malus Infinium whole genome genotyping array. BMC genomics. 2012; 13:203.
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Apple-JM7xS63-F1S7N/A15.7CH04e05-15.7View
2Apple-JM7xS63-F1J7N/A17CH04e05-17View
3Pear-RM-F1-IntegratedLG7N/A75.02CH04e05-75.022View
4Pear-M-F1-maleLG7N/A84.13CH04e05-84.129View
5Pear-Rcf-F1-femaleLG7N/A43.2CH04e05-43.199View
6Pear-integrated_consensus_map-IPCG-2017LG7N/A33.91CH04e05-33.91View
7Pear-Dangshansuli-F1-2015LG7N/A36.79CH04e05-36.786View
8Pear-Bayuehong-F1-2015LG7N/A37.94CH04e05-37.936View
9Pear-BD-F1-2015LG7N/A37.9CH04e05-37.9View
10Pear-Ba-F1-2013Ba7N/A22.3CH04e05-22.3View
11Apple-FD-Discovery-F1-2003D7N/A34.5CH04e05View
12Pear-La_France-F1-2007La7N/A38.5CH04e05View
13Pear-Bartlett-F1-2007Ba7N/A36.3CH04e05View
14Apple-FjxPL-F1-2013LG7N/A53.7CH04e05View
15Apple-FD-F1-2006F7N/A27.3CH04e05View
16Apple-FD-F1-2006D7N/A34.7CH04e05View
17Pear-BH-F1Ba7N/A20.8CH04e05View
18Apple-PF-F1-2004F7N/A20CH04e05View
19Apple Integrated map7N/A31.9CH04e05View
20Apple-FD-Fiesta-F1-20037N/A26.7CH04e05View
21Apple-IM-F1-IdaredIda LG 7N/A13.6CH04e05View
22Apple-MAL0045_x_Idared-F1-MfuscaLG7aN/A21.7CH04e05View
23Pear-PM-F1-Moonglow7N/A24.01CH04e05View
24Apple-2000-2012-F1ch7N/A37CH04e05View
25Apple-MM-F17N/A28.1CH04e05View
26Apple-GDxJ-F1-2012LG7N/A36.8CH04e05View
27Apple-M432-2012LG7N/A25.1CH04e05View
28Apple-JGD-F1-2014J7N/A33CH04e05View
29Apple-RGTxGD-F1-2015RGT_7N/A17.95CH04e05View
30Apple-DP-F1-2013D7N/A41.5CH04e05View
31Apple-DP-F1-2013P7N/A45.5CH04e05View