CH05b06, CH05b06 (genetic_marker) Malus x domestica

Marker Overview
NameCH05b06
AliasCH05b06_5-6_FM
CH05b06b
CH05b06a
CH05b06w
CH05b06v
CH05b06u
CH05b06.x
Genbank IDN/A
TypeSSR
SpeciesMalus x domestica
Repeat MotifGA
PCR Conditionannealing temp 60 degree
Primer 1CH05b06.forward: CAC GAC GTT GTA AAA CGA CACA AGC AAA CCT AAT ACC ACC G
Primer 2CH05b06.primer 1: ACAAGCAAACCTAATACCACCG
Primer 3CH05b06.primer 2: GAGACTGGAAGAGTTGCAGAGG
Primer 4CH05b06.reverse: GAG ACT GGA AGA GTT GCA GAG G
Product Length138-226
PolymorphismP_ CH05b06
Publication[view all]
ContactC. Gessler
Comment
Contact
NameDetails
C. Gessler
First name:Cesare
Last name:Gessler
Institution:ETH Zurich
Address:ZTH Zurich Institut f. Integrative Biologie LFW C 15 Universitatstrasse 2 8092 Zurich
Country:Switzerland
Email:cesare.gessler@agrl.ethz.ch
Phone:+41 44 632 38 71
Fax:+41 (0) 632 11 08
Last update:May 2002
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
primer 1CH05b06.primer 1Malus x domesticaprimer
primer 2CH05b06.primer 2Malus x domesticaprimer
forwardCH05b06.forwardMalus x domesticaprimer
reverseCH05b06.reverseMalus x domesticaprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
CH05b06CH05b06-2.5Malus x domesticamarker_locus
CH05b06CH05b06-3.4Malus x domesticamarker_locus
CH05b06CH05b06-2.6Malus x domesticamarker_locus
CH05b06CH05b06-1.7Malus x domesticamarker_locus
CH05b06CH05b06-4.3Malus x domesticamarker_locus
CH05b06CH05b06-14.8Malus x domesticamarker_locus
CH05b06zCH05b06zMalus x domesticamarker_locus
CH05b06yCH05b06yMalus x domesticamarker_locus
CH05b06xCH05b06xMalus x domesticamarker_locus
CH05b06uCH05b06uMalus x domesticamarker_locus
CH05b06wCH05b06wMalus x domesticamarker_locus
CH05b06vCH05b06vMalus x domesticamarker_locus
CH05b06.xCH05b06.xMalus x domesticamarker_locus
CH05b06CH05b06Malus x domesticamarker_locus
CH05b06.wCH05b06.wMalus x domesticamarker_locus


Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Apple-JM7xS63-F1J17N/A2.5CH05b06-2.5View
2Apple-JM7xS63-F1J16N/A3.4CH05b06-3.4View
3Apple-JM7xS63-F1S15N/A2.6CH05b06-2.6View
4Apple-JM7xS63-F1J15N/A1.7CH05b06-1.7View
5Apple-JM7xS63-F1S5N/A4.3CH05b06-4.3View
6Apple-JM7xS63-F1J5N/A14.8CH05b06-14.8View
7Apple Integrated map5N/A5.6CH05b06zView
8Apple-FD-F1-2006D5N/A7.7CH05b06zView
9Apple-FD-F1-2006F5N/A6.8CH05b06zView
10Apple-FD-F1-2006F16N/A15.7CH05b06yView
11Apple Integrated map10N/A3.4CH05b06yView
12Apple-IM-F1-IdaredIda LG 16N/A0CH05b06yView
13Apple-IM-F1-Mr5Mr5 LG 16N/A0CH05b06yView
14Apple-FD-F1-2006F16N/A4.1CH05b06xView
15Apple-IM-F1-Mr5Mr5 LG 17N/A22.1CH05b06uView
16Apple-MAL0045_x_Idared-F1-MfuscaLG17N/A0.2CH05b06uView
17Apple-MAL0045_x_Idared-F1-MfuscaLG3N/A54.4CH05b06wView
18Apple-IM-F1-Mr5Mr5 LG 7N/A14.9CH05b06vView
19Apple-MAL0045_x_Idared-F1-MfuscaLG7aN/A0CH05b06vView
20Apple-MM-F110N/A4.1CH05b06.xView
21Apple-M432-2012LG10N/A0CH05b06.xView
22Apple-JM7xS63-F1J17N/A2.5CH05b06View
23Apple-JM7xS63-F1S16N/A0CH05b06View
24Apple-X3259X3263-F110N/A0CH05b06View
25Apple-M432-2012LG3N/A55.1CH05b06.wView