CH05c06, CH05c06 (genetic_marker) Malus x domestica

Marker Overview
NameCH05c06
AliasCH05c06_FM
CH05c06
Genbank IDN/A
TypeSSR
SpeciesMalus x domestica
Repeat MotifGA
PCR Conditionannealing temp 60 degree
Primer 1CH05c06.forward: CAC GAC GTT GTA AAA CGA CATT GGA ACT CTC CGT ATT GTG C
Primer 2CH05c06.primer 1: ATTGGAACTCTCCGTATTGTGC
Primer 3CH05c06.primer 2: ATCAACAGTAGTGGTAGCCGGT
Primer 4CH05c06.reverse: ATC AAC AGT AGT GGT AGC CGG T
Product Length104-126
PolymorphismP_ CH05c06
Publication[view all]
ContactC. Gessler
Miyuki Kunihisa
Comment
Contact
NameDetails
C. Gessler
First name:Cesare
Last name:Gessler
Institution:ETH Zurich
Address:ZTH Zurich Institut f. Integrative Biologie LFW C 15 Universitatstrasse 2 8092 Zurich
Country:Switzerland
Email:cesare.gessler@agrl.ethz.ch
Phone:+41 44 632 38 71
Fax:+41 (0) 632 11 08
Last update:May 2002
Miyuki Kunihisa
First name:Miyuki
Last name:Kunihisa
Institution:NARO Institute of Fruit Tree Science
Address:2-1 Fujimoto, Tsukuba, Ibaraki 305-8605
Country:Japan
Email:miyuky@affrc.go.jp
Phone:81-29-838-6437
Keywords:fruit drop
Relationships

This genetic_marker is adjacent to the following QTL feature(s):

Feature NameUnique NameSpeciesType
titratable acidityqTITA.FjMp-LG16Malus x domesticaQTL
Juice browningqJB.FjMp-LG16Malus x domesticaQTL
fruit juicinessqFRJUC.OA-ch16-OrinMalus x domesticaQTL
titratable acidityqTITA.OA-ch16-OrinMalus x domesticaQTL
total water soluble contentqSSC.OA-ch16-OrinMalus x domesticaQTL
resistance to Botryosphaeria dothideaqRBD.JGD-chJ16.2009Malus x domesticaQTL
epicatechin contentqECAT.X5210X8402-LG16.J10Malus x domesticaQTL
phenolic compound contentqPHE.X5210X8402-LG16.F09.procyanidinB1Malus x domesticaQTL
phenolic compound contentqPHE.X5210X8402-LG16.F08.DPnFlavanolsMalus x domesticaQTL
phenolic compound contentqPHE.X5210X8402-LG16.F08.DPnProcyanidinsMalus x domesticaQTL


This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
primer 1CH05c06.primer 1Malus x domesticaprimer
primer 2CH05c06.primer 2Malus x domesticaprimer
forwardCH05c06.forwardMalus x domesticaprimer
reverseCH05c06.reverseMalus x domesticaprimer


This genetic_marker is located in the following QTL feature(s):

Feature NameUnique NameSpeciesType
bitter pitqBTPT.RX-LG16Malus x domesticaQTL


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
CH05c06CH05c06-12.8Malus x domesticamarker_locus
CH05c06CH05c06-13.8Malus x domesticamarker_locus
CH05c06CH05c06-16Malus x domesticamarker_locus
CH05c06CH05c06-15.4Malus x domesticamarker_locus
CH05c06CH05c06-21.9Malus x domesticamarker_locus
CH05c06CH05c06-128.306Malus x domesticamarker_locus
CH05c06CH05c06-135.203Malus x domesticamarker_locus
CH05c06CH05c06-39.23Malus x domesticamarker_locus
CH05c06CH05c06-21.53Malus x domesticamarker_locus
CH05c06CH05c06-10.552Malus x domesticamarker_locus
CH05c06CH05c06-15.6Malus x domesticamarker_locus
CH05c06CH05c06Malus x domesticamarker_locus


Publications
YearPublication
2009Celton J-M, Tustin DS, Chagne D, Gardiner SE. Construction of a dense genetic linkage map for apple rootstocks using SSRs developed from Malus ESTs and Pyrus genomic sequences. Tree Genetics and Genomes. 2009; 5(1):93-107.
2006Silfverberg-Dilworth E, Matasci CL, Van de Weg WE, Van Kaauwen MPW, Walser M, Kodde LP, Soglio V, Gianfranceschi L, Durel CE, Costa F, Yamamoto T, Koller B, Gessler C Patocchi A. Microsatellite markers spanning the apple (Malus x domestica Borkh.) genome. Tree Genetics and Genomes. 2006; 2(4):202-224.
2010Velasco R, Zharkikh A, Affourtit J, Dhingra A, Cestaro A, Kalyanaraman A, Fontana P, Bhatnagar SK, Troggio M, Pruss D, Salvi S, Pindo M, Baldi P, Castelletti S, Cavaiuolo M, Coppola G, Costa F, Cova V, Dal Ri A, Goremykin V, Komjanc M, Longhi S, Magnago P, Malacarne G, Malnoy M, Micheletti D, Moretto M, Perazzolli M, Si-Ammour A, Vezzulli S, Zini E, Eldredge G, Fitzgerald LM, Gutin N, Lanchbury J, Macalma T, Mitchell JT, Reid J, Wardell B, Kodira C, Chen Z, Desany B, Niazi F, Palmer M, Koepke T, Jiwan D, Schaeffer S, Krishnan V, Wu C, Chu VT, King ST, Vick J, Tao Q, Mraz A, Stormo A, Stormo K, Bogden R, Ederle D, Stella A, Vecchietti A, Kater MM, Masiero S, Lasserre P, Lespinasse Y, Allan AC, Bus V, Chagné D, Crowhurst RN, Gleave AP, Lavezzo E, Fawcett JA, Proost S, Rouzé P, Sterck L, Toppo S, Lazzari B, Hellens RP, Durel CE, Gutin A, Bumgarner RE, Gardiner SE, Skolnick M, Egholm M, Van de Peer Y, Salamini F, Viola R. The genome of the domesticated apple (Malus x domestica Borkh.). Nature Genetics. 2010 Oct; 42(10):833-839.
2002Liebhard, R., Gianfranceschi, L., Koller, B., Ryder, C.D., Tarchini, R., Weg, E. van de., Gessler, C. Development and characterisation of 140 new microsatellites in apple (Malus x domestica Borkh.) Mol. breed. 2002. v. 10 (4) p. 217-241.
2012Antanaviciute L, Fernández-Fernández F, Jansen J, Banchi E, Evans KM, Viola R, Velasco R, Dunwell JM, Troggio M, Sargent DJ. Development of a dense SNP-based linkage map of an apple rootstock progeny using the Malus Infinium whole genome genotyping array. BMC genomics. 2012; 13:203.
2014Kunihisa M, Moriya S, Abe K, Okada K, Haji T, Hayashi T, Kim H, Nishitani C, Terakami S, Yamamoto T. Identification of QTLs for fruit quality traits in Japanese apples: QTLs for early ripening are tightly related to preharvest fruit drop. Breeding science. 2014 Sep; 64(3):240-51.
2015Ben Sadok I, Tiecher A, Galvez-Lopez D, Lahaye M, Lasserre-Zuber P, Bruneau M, Hanteville S, Robic R, Cournol R, Laurens F. Apple fruit texture QTLs: year and cold storage effects on sensory and instrumental traits. Tree Genetics & Genomes 2015 11:119
2004Plant Breeding, 123(4):321
2002R. Liebhard, L. Gianfranceschi, B. Koller, C.D. Ryder, R. Tarchini, E. Van De Weg, C. Gessler. Development and characterization of 140 new microsatellites in apple. Molecular Breeding December 2002, 10(4):217-241
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Apple-JM7xS63-F1S16N/A12.8CH05c06-12.8View
2Apple-JM7xS63-F1J16N/A13.8CH05c06-13.8View
3Apple-JM7xS63-F1S13N/A16CH05c06-16View
4Apple-JM7xS63-F1J13N/A15.4CH05c06-15.4View
5Apple-FjMp-F1LG16N/A21.9CH05c06-21.9View
6Pear-RM-F1-IntegratedLG16N/A128.31CH05c06-128.306View
7Pear-M-F1-maleLG16N/A135.2CH05c06-135.203View
8Pear-integrated_consensus_map-IPCG-2017LG16N/A39.23CH05c06-39.23View
9Pear-integrated_consensus_map-IPCG-2017LG13N/A21.53CH05c06-21.53View
10Pear-Bayuehong-F1-2015LG16N/A10.55CH05c06-10.552View
11Pear-BD-F1-2015LG16N/A15.6CH05c06-15.6View
12Apple-FD-Discovery-F1-2003D16N/A15.3CH05c06View
13Apple-GDxBr-F1-2013LG16N/A1.08CH05c06View
14Apple-JM7xS63-F1J13N/A15.4CH05c06View
15Apple-FD-F1-2006F16N/A11.1CH05c06View
16Apple-FD-F1-2006D16N/A14.4CH05c06View
17Apple Integrated map16N/A7.4CH05c06View
18Apple-MM-F116N/A11.4CH05c06View
19Apple-OA-F1-OrinOR16N/A6.6CH05c06View
20Apple-OA-F1-AkaneAK16N/A14.7CH05c06View
21Apple-X3259X3263-F116N/A3.54CH05c06View
22Apple-GDxJ-F1-2012LG16.1N/A62CH05c06View
23apple-RX-F2LG16N/A4.14CH05c06View
24Apple-M432-2012LG16N/A11.2CH05c06View
25Apple-RGTxGD-F1-2015RGT_13N/A15.88CH05c06View
26Apple-RGTxGD-F1-2015GD_13N/A20.42CH05c06View
27Apple-RGxPI6-F1LG16N/A11.1CH05c06View
28Apple-X5210X8402-F1-X5210LG16N/A10.8CH05c06View
29Apple-X5210X8402-F1-X8402LG16N/A17.2CH05c06View