CH05e04, CH05e04 (genetic_marker) Malus x domestica

Marker Overview
NameCH05e04
Genbank IDN/A
TypeSSR
SpeciesMalus x domestica
Repeat MotifGA
PCR Conditionannealing temp 60 degree
Primer 1CH05e04.forward: CAC GAC GTT GTA AAA CGA CAA GGA GAA GAC CGT GTG AAA TC
Primer 2CH05e04.primer 1: AAGGAGAAGACCGTGTGAAATC
Primer 3CH05e04.primer 2: CATGGATAAGGCATAGTCAGGA
Primer 4CH05e04.reverse: CAT GGA TAA GGC ATA GTC AGG A
Product Length153-234
PolymorphismP_ CH05e04
Publication[view all]
ContactC. Gessler
Miyuki Kunihisa
Comment
Contact
NameDetails
C. Gessler
First name:Cesare
Last name:Gessler
Institution:ETH Zurich
Address:ZTH Zurich Institut f. Integrative Biologie LFW C 15 Universitatstrasse 2 8092 Zurich
Country:Switzerland
Email:cesare.gessler@agrl.ethz.ch
Phone:+41 44 632 38 71
Fax:+41 (0) 632 11 08
Last update:May 2002
Miyuki Kunihisa
First name:Miyuki
Last name:Kunihisa
Institution:NARO Institute of Fruit Tree Science
Address:2-1 Fujimoto, Tsukuba, Ibaraki 305-8605
Country:Japan
Email:miyuky@affrc.go.jp
Phone:81-29-838-6437
Keywords:fruit drop
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
primer 1CH05e04.primer 1Malus x domesticaprimer
primer 2CH05e04.primer 2Malus x domesticaprimer
forwardCH05e04.forwardMalus x domesticaprimer
reverseCH05e04.reverseMalus x domesticaprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
CH05e04zCH05e04zMalus x domesticamarker_locus
CH05e04CH05e04Malus x domesticamarker_locus


Publications
YearPublication
2010Velasco R, Zharkikh A, Affourtit J, Dhingra A, Cestaro A, Kalyanaraman A, Fontana P, Bhatnagar SK, Troggio M, Pruss D, Salvi S, Pindo M, Baldi P, Castelletti S, Cavaiuolo M, Coppola G, Costa F, Cova V, Dal Ri A, Goremykin V, Komjanc M, Longhi S, Magnago P, Malacarne G, Malnoy M, Micheletti D, Moretto M, Perazzolli M, Si-Ammour A, Vezzulli S, Zini E, Eldredge G, Fitzgerald LM, Gutin N, Lanchbury J, Macalma T, Mitchell JT, Reid J, Wardell B, Kodira C, Chen Z, Desany B, Niazi F, Palmer M, Koepke T, Jiwan D, Schaeffer S, Krishnan V, Wu C, Chu VT, King ST, Vick J, Tao Q, Mraz A, Stormo A, Stormo K, Bogden R, Ederle D, Stella A, Vecchietti A, Kater MM, Masiero S, Lasserre P, Lespinasse Y, Allan AC, Bus V, Chagné D, Crowhurst RN, Gleave AP, Lavezzo E, Fawcett JA, Proost S, Rouzé P, Sterck L, Toppo S, Lazzari B, Hellens RP, Durel CE, Gutin A, Bumgarner RE, Gardiner SE, Skolnick M, Egholm M, Van de Peer Y, Salamini F, Viola R. The genome of the domesticated apple (Malus x domestica Borkh.). Nature Genetics. 2010 Oct; 42(10):833-839.
2002Liebhard, R., Gianfranceschi, L., Koller, B., Ryder, C.D., Tarchini, R., Weg, E. van de., Gessler, C. Development and characterisation of 140 new microsatellites in apple (Malus x domestica Borkh.) Mol. breed. 2002. v. 10 (4) p. 217-241.
2012Schouten HJ, van de Weg WE, Carling J, Khan SI, McKay SJ, van Kaauwen MPW, Wittenberg AHJ, Koehorst-van Putten HJJ, Noordijk Y, Gao Z, Rees DJG, Van Dyk MM, Jaccoud D, Considine MJ, Kilian A. Diversity arrays technology (DArT) markers in apple for genetic linkage maps. Molecular breeding 2012 29:645–660
2014Kunihisa M, Moriya S, Abe K, Okada K, Haji T, Hayashi T, Kim H, Nishitani C, Terakami S, Yamamoto T. Identification of QTLs for fruit quality traits in Japanese apples: QTLs for early ripening are tightly related to preharvest fruit drop. Breeding science. 2014 Sep; 64(3):240-51.
2002R. Liebhard, L. Gianfranceschi, B. Koller, C.D. Ryder, R. Tarchini, E. Van De Weg, C. Gessler. Development and characterization of 140 new microsatellites in apple. Molecular Breeding December 2002, 10(4):217-241
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Apple-FD-F1-2006F16N/A11.6CH05e04zView
2Apple-FD-F1-2006D16N/A17CH05e04zView
3Apple-PF-F1-2004P16N/A7CH05e04View
4Apple Integrated map16N/A7.4CH05e04View
5Apple-PF-F1-2012ch16N/A12CH05e04View
6Apple-OA-F1-AkaneAK16N/A14.7CH05e04View