Hi03a10, Hi03a10 (genetic_marker) Malus x domestica

Marker Overview
NameHi03a10
AliasHi03a10_F
Genbank IDN/A
TypeSSR
SpeciesMalus x domestica
Repeat MotifGA
PCR Conditionannealing temp 60 degree
Primer 1Hi03a10.R: GTTTCAGGGAACTTGTTTGATGG
Primer 2Hi03a10.primer 1: GGACCTGCTTCCCCTTATTC
Primer 3Hi03a10.primer 2: CAGGGAACTTGTTTGATGG
Product Length206-290
PolymorphismP_ Hi03a10
Publication[view all]
ContactA. Patocchi
Andreas Peil
Miyuki Kunihisa
Andrea Patocchi
Contact
NameDetails
A. Patocchi
First name:Andrea
Last name:Patocchi
Institution:Agroscope Changins-W?denswil Research Station ACW
Address:Standort W?denswil Schloss Postfach 185 8820 W?denswil
Country:SWITZERLAND
Email:andrea.patocchi@acw.admin.ch
Phone:+41 44 783 6313
Fax:+41 (0)44 783 63 05
Andreas Peil
First name:Andreas
Last name:Peil
Title:Researcher
Institution:Institute for Breeding Research on Fruit
Address:Kulius Kuhn-Institut (JKI), Pillnitzer Platz 3a, 01326
Country:Dresden, Germany
Email:andreas.peil@jki.bund.de
Miyuki Kunihisa
First name:Miyuki
Last name:Kunihisa
Institution:NARO Institute of Fruit Tree Science
Address:2-1 Fujimoto, Tsukuba, Ibaraki 305-8605
Country:Japan
Email:miyuky@affrc.go.jp
Phone:81-29-838-6437
Keywords:fruit drop
Andrea Patocchi
First name:Andrea
Last name:Patocchi
Title:researcher
Institution:Plant Pathology, Institute of Integrative Biology (IBZ)
Address:ETH Zurich, CH-8092 Zurich, Switzerland
Country:Switzerland
Email:andrea.patocchi@agrl.ethz.ch
Keywords:SSR
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
RHi03a10.RMalus x domesticaprimer
primer 1Hi03a10.primer 1Malus x domesticaprimer
primer 2Hi03a10.primer 2Malus x domesticaprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
Hi03a10Hi03a10-10.7Malus x domesticamarker_locus
Hi03a10Hi03a10-9Malus x domesticamarker_locus
Hi03a10Hi03a10Malus x domesticamarker_locus


Publications
YearPublication
2010Velasco R, Zharkikh A, Affourtit J, Dhingra A, Cestaro A, Kalyanaraman A, Fontana P, Bhatnagar SK, Troggio M, Pruss D, Salvi S, Pindo M, Baldi P, Castelletti S, Cavaiuolo M, Coppola G, Costa F, Cova V, Dal Ri A, Goremykin V, Komjanc M, Longhi S, Magnago P, Malacarne G, Malnoy M, Micheletti D, Moretto M, Perazzolli M, Si-Ammour A, Vezzulli S, Zini E, Eldredge G, Fitzgerald LM, Gutin N, Lanchbury J, Macalma T, Mitchell JT, Reid J, Wardell B, Kodira C, Chen Z, Desany B, Niazi F, Palmer M, Koepke T, Jiwan D, Schaeffer S, Krishnan V, Wu C, Chu VT, King ST, Vick J, Tao Q, Mraz A, Stormo A, Stormo K, Bogden R, Ederle D, Stella A, Vecchietti A, Kater MM, Masiero S, Lasserre P, Lespinasse Y, Allan AC, Bus V, Chagné D, Crowhurst RN, Gleave AP, Lavezzo E, Fawcett JA, Proost S, Rouzé P, Sterck L, Toppo S, Lazzari B, Hellens RP, Durel CE, Gutin A, Bumgarner RE, Gardiner SE, Skolnick M, Egholm M, Van de Peer Y, Salamini F, Viola R. The genome of the domesticated apple (Malus x domestica Borkh.). Nature Genetics. 2010 Oct; 42(10):833-839.
2006Silfverberg-Dilworth E, Matasci CL, Van de Weg WE, Van Kaauwen MPW, Walser M, Kodde LP, Soglio V, Gianfranceschi L, Durel CE, Costa F, Yamamoto T, Koller B, Gessler C Patocchi A. Microsatellite markers spanning the apple (Malus x domestica Borkh.) genome. Tree Genetics and Genomes. 2006; 2(4):202-224.
2014Wöhner TW, Flachowsky H, Richter K, Garcia-Libreros T, Trognitz F, Hanke M, Peil A. QTL mapping of fire blight resistance in Malus ×robusta 5 after inoculation with different strains of Erwinia amylovora. Molecular breeding. 2014; 34(1):217-230.
2014Kunihisa M, Moriya S, Abe K, Okada K, Haji T, Hayashi T, Kim H, Nishitani C, Terakami S, Yamamoto T. Identification of QTLs for fruit quality traits in Japanese apples: QTLs for early ripening are tightly related to preharvest fruit drop. Breeding science. 2014 Sep; 64(3):240-51.
2015Ben Sadok I, Tiecher A, Galvez-Lopez D, Lahaye M, Lasserre-Zuber P, Bruneau M, Hanteville S, Robic R, Cournol R, Laurens F. Apple fruit texture QTLs: year and cold storage effects on sensory and instrumental traits. Tree Genetics & Genomes 2015 11:119
2002Liebhard, R., Gianfranceschi, L., Koller, B., Ryder, C.D., Tarchini, R., Weg, E. van de., Gessler, C. Development and characterisation of 140 new microsatellites in apple (Malus x domestica Borkh.) Mol. breed. 2002. v. 10 (4) p. 217-241.
2004Plant Breeding, 123(4):321
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Apple-JM7xS63-F1S7N/A10.7Hi03a10-10.7View
2Apple-JM7xS63-F1J7N/A9Hi03a10-9View
3Apple-FD-F1-2006D7N/A26.2Hi03a10View
4Apple-FD-F1-2006F7N/A14.4Hi03a10View
5Apple Integrated map7N/A20.3Hi03a10View
6Apple-IM-F1-IdaredIda LG 7N/A4.6Hi03a10View
7Apple-OA-F1-OrinOR7N/A19Hi03a10View
8Apple-OA-F1-AkaneAK7N/A15.4Hi03a10View
9Apple-X3259X3263-F17N/A39.31Hi03a10View
10Apple-RGTxGD-F1-2015RGT_7N/A14.93Hi03a10View
11Apple-RGTxGD-F1-2015GD_7N/A21.1Hi03a10View
12Apple-DP-F1-2013D7N/A23.4Hi03a10View
13Apple-DP-F1-2013P7N/A29Hi03a10View