Hi04b12, Hi04b12 (genetic_marker) Malus x domestica

Marker Overview
NameHi04b12
AliasHi04b12_FM
Hi04b12y
Hi04b12z
Hi04b12
Genbank IDN/A
TypeSSR
SpeciesMalus x domestica
Repeat MotifGA
PCR Conditionannealing temp 60 degree
Primer 1Hi04b12.primer 1: CCCAAACTCCCAACAAAGC
Primer 2Hi04b12.primer 2: GTTTGAGCAGAGGTTGCTGTTGC
Product Length140-156
PolymorphismP_ Hi04b12
Publication[view all]
ContactA. Patocchi
Miyuki Kunihisa
Contact
NameDetails
A. Patocchi
First name:Andrea
Last name:Patocchi
Institution:Agroscope Changins-W?denswil Research Station ACW
Address:Standort W?denswil Schloss Postfach 185 8820 W?denswil
Country:SWITZERLAND
Email:andrea.patocchi@acw.admin.ch
Phone:+41 44 783 6313
Fax:+41 (0)44 783 63 05
Miyuki Kunihisa
First name:Miyuki
Last name:Kunihisa
Institution:NARO Institute of Fruit Tree Science
Address:2-1 Fujimoto, Tsukuba, Ibaraki 305-8605
Country:Japan
Email:miyuky@affrc.go.jp
Phone:81-29-838-6437
Keywords:fruit drop
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
primer 1Hi04b12.primer 1Malus x domesticaprimer
primer 2Hi04b12.primer 2Malus x domesticaprimer


This genetic_marker is adjacent to the following QTL feature(s):

Feature NameUnique NameSpeciesType
phenolic compound contentqPHE.X5210X8402-LG8.J10.procyanidinB5Malus x domesticaQTL


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
Hi04b12Hi04b12Malus x domesticamarker_locus
Hi04b12yHi04b12yMalus x domesticamarker_locus
Hi04b12zHi04b12zMalus x domesticamarker_locus


Publications
YearPublication
2010Velasco R, Zharkikh A, Affourtit J, Dhingra A, Cestaro A, Kalyanaraman A, Fontana P, Bhatnagar SK, Troggio M, Pruss D, Salvi S, Pindo M, Baldi P, Castelletti S, Cavaiuolo M, Coppola G, Costa F, Cova V, Dal Ri A, Goremykin V, Komjanc M, Longhi S, Magnago P, Malacarne G, Malnoy M, Micheletti D, Moretto M, Perazzolli M, Si-Ammour A, Vezzulli S, Zini E, Eldredge G, Fitzgerald LM, Gutin N, Lanchbury J, Macalma T, Mitchell JT, Reid J, Wardell B, Kodira C, Chen Z, Desany B, Niazi F, Palmer M, Koepke T, Jiwan D, Schaeffer S, Krishnan V, Wu C, Chu VT, King ST, Vick J, Tao Q, Mraz A, Stormo A, Stormo K, Bogden R, Ederle D, Stella A, Vecchietti A, Kater MM, Masiero S, Lasserre P, Lespinasse Y, Allan AC, Bus V, Chagné D, Crowhurst RN, Gleave AP, Lavezzo E, Fawcett JA, Proost S, Rouzé P, Sterck L, Toppo S, Lazzari B, Hellens RP, Durel CE, Gutin A, Bumgarner RE, Gardiner SE, Skolnick M, Egholm M, Van de Peer Y, Salamini F, Viola R. The genome of the domesticated apple (Malus x domestica Borkh.). Nature Genetics. 2010 Oct; 42(10):833-839.
2006Silfverberg-Dilworth E, Matasci CL, Van de Weg WE, Van Kaauwen MPW, Walser M, Kodde LP, Soglio V, Gianfranceschi L, Durel CE, Costa F, Yamamoto T, Koller B, Gessler C Patocchi A. Microsatellite markers spanning the apple (Malus x domestica Borkh.) genome. Tree Genetics and Genomes. 2006; 2(4):202-224.
2014Emeriewen O, Richter K, Kilian A, Zini E, Hanke M, Malnoy M, Peil A. Identification of a major quantitative trait locus for resistance to fire blight in the wild apple species Malus fusca. Molecular breeding. 2014; 34(2):407-419.
2012Antanaviciute L, Fernández-Fernández F, Jansen J, Banchi E, Evans KM, Viola R, Velasco R, Dunwell JM, Troggio M, Sargent DJ. Development of a dense SNP-based linkage map of an apple rootstock progeny using the Malus Infinium whole genome genotyping array. BMC genomics. 2012; 13:203.
2014Kunihisa M, Moriya S, Abe K, Okada K, Haji T, Hayashi T, Kim H, Nishitani C, Terakami S, Yamamoto T. Identification of QTLs for fruit quality traits in Japanese apples: QTLs for early ripening are tightly related to preharvest fruit drop. Breeding science. 2014 Sep; 64(3):240-51.
2015Ben Sadok I, Tiecher A, Galvez-Lopez D, Lahaye M, Lasserre-Zuber P, Bruneau M, Hanteville S, Robic R, Cournol R, Laurens F. Apple fruit texture QTLs: year and cold storage effects on sensory and instrumental traits. Tree Genetics & Genomes 2015 11:119
2002Liebhard, R., Gianfranceschi, L., Koller, B., Ryder, C.D., Tarchini, R., Weg, E. van de., Gessler, C. Development and characterisation of 140 new microsatellites in apple (Malus x domestica Borkh.) Mol. breed. 2002. v. 10 (4) p. 217-241.
2004Plant Breeding, 123(4):321
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Apple Integrated map8N/A63.5Hi04b12View
2Apple-FD-F1-2006F8N/A6.3Hi04b12View
3Apple-FD-F1-2006D8N/A14.7Hi04b12View
4Apple-STKxGS-F18N/A19.4Hi04b12View
5Apple-MM-F18N/A12.3Hi04b12View
6Apple-OA-F1-AkaneAK8N/A5.3Hi04b12View
7Apple-X3259X3263-F18N/A16.18Hi04b12View
8Apple-M432-2012LG8N/A0Hi04b12View
9Apple-X5210X8402-F1-X5210LG8N/A14.2Hi04b12View
10Apple-X5210X8402-F1-X8402LG8N/A0Hi04b12View
11Apple-MAL0045_x_Idared-F1-MfuscaLG8AN/A0Hi04b12yView
12Apple-MAL0045_x_Idared-F1-MfuscaLG8BN/A15.2Hi04b12zView