Hi04e04, Hi04e04 (genetic_marker) Malus x domestica

Marker Overview
NameHi04e04
AliasHi04e04
Genbank IDN/A
TypeSSR
SpeciesMalus x domestica
Repeat MotifGA
PCR Conditionannealing temp 60 degree
Primer 1Hi04e04.primer 1: GACCACGAAGCGCTGTTAAG
Primer 2Hi04e04.primer 2: GTTTCGGTAATTCCTTCCATCTTG
Product Length216-246
PolymorphismP_ Hi04e04
Publication[view all]
ContactA. Patocchi
Andreas Peil
Contact
NameDetails
A. Patocchi
First name:Andrea
Last name:Patocchi
Institution:Agroscope Changins-W?denswil Research Station ACW
Address:Standort W?denswil Schloss Postfach 185 8820 W?denswil
Country:SWITZERLAND
Email:andrea.patocchi@acw.admin.ch
Phone:+41 44 783 6313
Fax:+41 (0)44 783 63 05
Andreas Peil
First name:Andreas
Last name:Peil
Title:Researcher
Institution:Institute for Breeding Research on Fruit
Address:Kulius Kuhn-Institut (JKI), Pillnitzer Platz 3a, 01326
Country:Dresden, Germany
Email:andreas.peil@jki.bund.de
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
primer 1Hi04e04.primer 1Malus x domesticaprimer
primer 2Hi04e04.primer 2Malus x domesticaprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
Hi04e04Hi04e04-28Malus x domesticamarker_locus
Hi04e04Hi04e04-20.6Malus x domesticamarker_locus
Hi04e04Hi04e04-32.2Malus x domesticamarker_locus
Hi04e04Hi04e04-60.76Malus x domesticamarker_locus
Hi04e04Hi04e04-11.8Malus x domesticamarker_locus
Hi04e04Hi04e04Malus x domesticamarker_locus


Publications
YearPublication
2010Velasco R, Zharkikh A, Affourtit J, Dhingra A, Cestaro A, Kalyanaraman A, Fontana P, Bhatnagar SK, Troggio M, Pruss D, Salvi S, Pindo M, Baldi P, Castelletti S, Cavaiuolo M, Coppola G, Costa F, Cova V, Dal Ri A, Goremykin V, Komjanc M, Longhi S, Magnago P, Malacarne G, Malnoy M, Micheletti D, Moretto M, Perazzolli M, Si-Ammour A, Vezzulli S, Zini E, Eldredge G, Fitzgerald LM, Gutin N, Lanchbury J, Macalma T, Mitchell JT, Reid J, Wardell B, Kodira C, Chen Z, Desany B, Niazi F, Palmer M, Koepke T, Jiwan D, Schaeffer S, Krishnan V, Wu C, Chu VT, King ST, Vick J, Tao Q, Mraz A, Stormo A, Stormo K, Bogden R, Ederle D, Stella A, Vecchietti A, Kater MM, Masiero S, Lasserre P, Lespinasse Y, Allan AC, Bus V, Chagné D, Crowhurst RN, Gleave AP, Lavezzo E, Fawcett JA, Proost S, Rouzé P, Sterck L, Toppo S, Lazzari B, Hellens RP, Durel CE, Gutin A, Bumgarner RE, Gardiner SE, Skolnick M, Egholm M, Van de Peer Y, Salamini F, Viola R. The genome of the domesticated apple (Malus x domestica Borkh.). Nature Genetics. 2010 Oct; 42(10):833-839.
2006Silfverberg-Dilworth E, Matasci CL, Van de Weg WE, Van Kaauwen MPW, Walser M, Kodde LP, Soglio V, Gianfranceschi L, Durel CE, Costa F, Yamamoto T, Koller B, Gessler C Patocchi A. Microsatellite markers spanning the apple (Malus x domestica Borkh.) genome. Tree Genetics and Genomes. 2006; 2(4):202-224.
2014Wöhner TW, Flachowsky H, Richter K, Garcia-Libreros T, Trognitz F, Hanke M, Peil A. QTL mapping of fire blight resistance in Malus ×robusta 5 after inoculation with different strains of Erwinia amylovora. Molecular breeding. 2014; 34(1):217-230.
2012Schouten HJ, van de Weg WE, Carling J, Khan SI, McKay SJ, van Kaauwen MPW, Wittenberg AHJ, Koehorst-van Putten HJJ, Noordijk Y, Gao Z, Rees DJG, Van Dyk MM, Jaccoud D, Considine MJ, Kilian A. Diversity arrays technology (DArT) markers in apple for genetic linkage maps. Molecular breeding 2012 29:645–660
2012Antanaviciute L, Fernández-Fernández F, Jansen J, Banchi E, Evans KM, Viola R, Velasco R, Dunwell JM, Troggio M, Sargent DJ. Development of a dense SNP-based linkage map of an apple rootstock progeny using the Malus Infinium whole genome genotyping array. BMC genomics. 2012; 13:203.
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Apple-JM7xS63-F1S16N/A28Hi04e04-28View
2Apple-JM7xS63-F1J16N/A20.6Hi04e04-20.6View
3Apple-FjMp-F1LG16N/A32.2Hi04e04-32.2View
4Pear-integrated_consensus_map-IPCG-2017LG16N/A60.76Hi04e04-60.76View
5Pear-Ba-F1-2013Ba16N/A11.8Hi04e04-11.8View
6Apple-FD-F1-2006F16N/A27.7Hi04e04View
7Apple-FD-F1-2006D16N/A29.8Hi04e04View
8Apple Integrated map16N/A23.9Hi04e04View
9Apple-IM-F1-IdaredIda LG 16N/A23.2Hi04e04View
10Apple-IM-F1-Mr5Mr5 LG 16N/A23.7Hi04e04View
11Apple-2000-2012-F1ch16N/A30Hi04e04View
12Apple-PF-F1-2012ch16N/A28Hi04e04View
13Apple-MM-F116N/A23.9Hi04e04View
14Apple-M432-2012LG16N/A25.3Hi04e04View
15Apple-RGTxGD-F1-2015RGT_16N/A20.87Hi04e04View