Hi07h02, Hi07h02 (genetic_marker) Malus x domestica

Marker Overview
Genbank IDN/A
SpeciesMalus x domestica
Repeat MotifGT
PCR Conditionannealing temp 60 degree
Primer 1Hi07h02.forward: CAAATTGGCAACTGGGTCTG
Primer 2Hi07h02.primer 1: CAAATTGGCAACTGGGTCTG
Product Length246-276
PolymorphismP_ Hi07h02
Publication[view all]
ContactA. Patocchi
Miyuki Kunihisa
Riccardo Velasco
A. Patocchi
First name:Andrea
Last name:Patocchi
Institution:Agroscope Changins-W?denswil Research Station ACW
Address:Standort W?denswil Schloss Postfach 185 8820 W?denswil
Phone:+41 44 783 6313
Fax:+41 (0)44 783 63 05
Miyuki Kunihisa
First name:Miyuki
Last name:Kunihisa
Institution:NARO Institute of Fruit Tree Science
Address:2-1 Fujimoto, Tsukuba, Ibaraki 305-8605
Keywords:fruit drop
Riccardo Velasco
First name:Riccardo
Last name:Velasco
Institution:IASMA Research and Innovation Centre
Address:Foundation Edmund Mach, Via E. Mach 1, 38010 San Michele all’Adige, Trento, Italy
Keywords:Venturia inaequalis

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
primer 1Hi07h02.primer 1Malus x domesticaprimer
primer 2Hi07h02.primer 2Malus x domesticaprimer
forwardHi07h02.forwardMalus x domesticaprimer
reverseHi07h02.reverseMalus x domesticaprimer

This genetic_marker is located in the following heritable_phenotypic_marker feature(s):

Feature NameUnique NameSpeciesType
Apple scab resistanceScab resistance-Rvi5Malus x domesticaheritable_phenotypic_marker

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
Hi07h02Hi07h02-61.2Malus x domesticamarker_locus
Hi07h02Hi07h02-51.8Malus x domesticamarker_locus
Hi07h02Hi07h02Malus x domesticamarker_locus

2010Velasco R, Zharkikh A, Affourtit J, Dhingra A, Cestaro A, Kalyanaraman A, Fontana P, Bhatnagar SK, Troggio M, Pruss D, Salvi S, Pindo M, Baldi P, Castelletti S, Cavaiuolo M, Coppola G, Costa F, Cova V, Dal Ri A, Goremykin V, Komjanc M, Longhi S, Magnago P, Malacarne G, Malnoy M, Micheletti D, Moretto M, Perazzolli M, Si-Ammour A, Vezzulli S, Zini E, Eldredge G, Fitzgerald LM, Gutin N, Lanchbury J, Macalma T, Mitchell JT, Reid J, Wardell B, Kodira C, Chen Z, Desany B, Niazi F, Palmer M, Koepke T, Jiwan D, Schaeffer S, Krishnan V, Wu C, Chu VT, King ST, Vick J, Tao Q, Mraz A, Stormo A, Stormo K, Bogden R, Ederle D, Stella A, Vecchietti A, Kater MM, Masiero S, Lasserre P, Lespinasse Y, Allan AC, Bus V, Chagné D, Crowhurst RN, Gleave AP, Lavezzo E, Fawcett JA, Proost S, Rouzé P, Sterck L, Toppo S, Lazzari B, Hellens RP, Durel CE, Gutin A, Bumgarner RE, Gardiner SE, Skolnick M, Egholm M, Van de Peer Y, Salamini F, Viola R. The genome of the domesticated apple (Malus x domestica Borkh.). Nature Genetics. 2010 Oct; 42(10):833-839.
2006Silfverberg-Dilworth E, Matasci CL, Van de Weg WE, Van Kaauwen MPW, Walser M, Kodde LP, Soglio V, Gianfranceschi L, Durel CE, Costa F, Yamamoto T, Koller B, Gessler C Patocchi A. Microsatellite markers spanning the apple (Malus x domestica Borkh.) genome. Tree Genetics and Genomes. 2006; 2(4):202-224.
2012Antanaviciute L, Fernández-Fernández F, Jansen J, Banchi E, Evans KM, Viola R, Velasco R, Dunwell JM, Troggio M, Sargent DJ. Development of a dense SNP-based linkage map of an apple rootstock progeny using the Malus Infinium whole genome genotyping array. BMC genomics. 2012; 13:203.
2014Kunihisa M, Moriya S, Abe K, Okada K, Haji T, Hayashi T, Kim H, Nishitani C, Terakami S, Yamamoto T. Identification of QTLs for fruit quality traits in Japanese apples: QTLs for early ripening are tightly related to preharvest fruit drop. Breeding science. 2014 Sep; 64(3):240-51.
2015Cova V, Bandara NL, Liang W, Tartarini S, Patocchi A, Troggio M, Velasco R, Komjanc M. Fine mapping of the Rvi5 (Vm) apple scab resistance locus in the ‘Murray’ apple genotype. Molecular Breeding. 2015. 35: 200.
2015Ben Sadok I, Tiecher A, Galvez-Lopez D, Lahaye M, Lasserre-Zuber P, Bruneau M, Hanteville S, Robic R, Cournol R, Laurens F. Apple fruit texture QTLs: year and cold storage effects on sensory and instrumental traits. Tree Genetics & Genomes 2015 11:119
2002Liebhard, R., Gianfranceschi, L., Koller, B., Ryder, C.D., Tarchini, R., Weg, E. van de., Gessler, C. Development and characterisation of 140 new microsatellites in apple (Malus x domestica Borkh.) Mol. breed. 2002. v. 10 (4) p. 217-241.
2004Plant Breeding, 123(4):321
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
4Apple Integrated map17N/A75.3Hi07h02View