Hi15a13, Hi15a13 (genetic_marker) Malus x domestica

Marker Overview
NameHi15a13
Genbank IDN/A
TypeSSR
SpeciesMalus x domestica
Repeat MotifCT
PCR Conditionannealing temp 60 degree
Primer 1Hi15a13.primer 1: TTCTCCCCTTCTAAACCAACC
Primer 2Hi15a13.primer 2: GGTTTCTTGGCGTAACATTG
Product Length220-234
PolymorphismP_ Hi15a13
Publication[view all]
ContactA. Patocchi
Miyuki Kunihisa
Contact
NameDetails
A. Patocchi
First name:Andrea
Last name:Patocchi
Institution:Agroscope Changins-W?denswil Research Station ACW
Address:Standort W?denswil Schloss Postfach 185 8820 W?denswil
Country:SWITZERLAND
Email:andrea.patocchi@acw.admin.ch
Phone:+41 44 783 6313
Fax:+41 (0)44 783 63 05
Miyuki Kunihisa
First name:Miyuki
Last name:Kunihisa
Institution:NARO Institute of Fruit Tree Science
Address:2-1 Fujimoto, Tsukuba, Ibaraki 305-8605
Country:Japan
Email:miyuky@affrc.go.jp
Phone:81-29-838-6437
Keywords:fruit drop
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
primer 1Hi15a13.primer 1Malus x domesticaprimer
primer 2Hi15a13.primer 2Malus x domesticaprimer


This genetic_marker is adjacent to the following QTL feature(s):

Feature NameUnique NameSpeciesType
fruit skin colorqFSC.OA-ch16-AkaneMalus x domesticaQTL
total water soluble contentqSSC.OA-ch16-AkaneMalus x domesticaQTL
fructose contentqFRU.OA-ch16-AkaneMalus x domesticaQTL
sorbitol contentqSOR.OA-ch16-AkaneMalus x domesticaQTL


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
Hi15a13Hi15a13-15.5Malus x domesticamarker_locus
Hi15a13Hi15a13-15.4Malus x domesticamarker_locus
Hi15a13Hi15a13-39.23Malus x domesticamarker_locus
Hi15a13Hi15a13-10.2Malus x domesticamarker_locus
Hi15a13Hi15a13Malus x domesticamarker_locus


Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Apple-JM7xS63-F1S16N/A15.5Hi15a13-15.5View
2Apple-JM7xS63-F1J16N/A15.4Hi15a13-15.4View
3Pear-integrated_consensus_map-IPCG-2017LG16N/A39.23Hi15a13-39.23View
4Pear-Ba-F1-2013Ba16N/A10.2Hi15a13-10.2View
5Apple-FD-F1-2006F16N/A13.3Hi15a13View
6Apple-OA-F1-AkaneAK16N/A1.5Hi15a13View