Hi15g11, Hi15g11 (genetic_marker) Malus x domestica

Marker Overview
NameHi15g11
Genbank IDN/A
TypeSSR
SpeciesMalus x domestica
Repeat MotifATC
PCR Conditionannealing temp 60 degree
Primer 1Hi15g11.primer 1: TGACATGCATAGGGTTACATGC
Primer 2Hi15g11.primer 2: GTTTGGGTTCGTAATCGTTCTTGTG
Product Length160-163
PolymorphismP_ Hi15g11
Publication[view all]
ContactA. Patocchi
Contact
NameDetails
A. Patocchi
First name:Andrea
Last name:Patocchi
Institution:Agroscope Changins-W?denswil Research Station ACW
Address:Standort W?denswil Schloss Postfach 185 8820 W?denswil
Country:SWITZERLAND
Email:andrea.patocchi@acw.admin.ch
Phone:+41 44 783 6313
Fax:+41 (0)44 783 63 05
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
primer 1Hi15g11.primer 1Malus x domesticaprimer
primer 2Hi15g11.primer 2Malus x domesticaprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
Hi15g11Hi15g11-56.51Malus x domesticamarker_locus
Hi15g11Hi15g11-25.315Malus x domesticamarker_locus
Hi15g11Hi15g11-23.524Malus x domesticamarker_locus
Hi15g11Hi15g11-24.8Malus x domesticamarker_locus
Hi15g11Hi15g11-10.2Malus x domesticamarker_locus
Hi15g11Hi15g11Malus x domesticamarker_locus


Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Pear-integrated_consensus_map-IPCG-2017LG16N/A56.51Hi15g11-56.51View
2Pear-Dangshansuli-F1-2015LG16N/A25.32Hi15g11-25.315View
3Pear-Bayuehong-F1-2015LG16N/A23.52Hi15g11-23.524View
4Pear-BD-F1-2015LG16N/A24.8Hi15g11-24.8View
5Pear-Ba-F1-2013Ba16N/A10.2Hi15g11-10.2View
6Apple-FD-F1-2006F16N/A28.6Hi15g11View