Hi23g12, Hi23g12 (genetic_marker) Malus x domestica

Marker Overview
NameHi23g12
AliasHi23g12_2_F
Hi23g12-1_SG
Hi23g12.z
Genbank IDN/A
TypeSSR
SpeciesMalus x domestica
Repeat MotifAAG-CCT-CTT
PCR Conditionannealing temp 60 degree
Primer 1Hi23g12.primer 1: CCCTTCCCTACCAAATGGAC
Primer 2Hi23g12.primer 2: GTTTAAAGGGGCCCACAAAGTG
Product Length223-241
PolymorphismP_ Hi23g12
Publication[view all]
ContactA. Patocchi
Andreas Peil
Contact
NameDetails
A. Patocchi
First name:Andrea
Last name:Patocchi
Institution:Agroscope Changins-W?denswil Research Station ACW
Address:Standort W?denswil Schloss Postfach 185 8820 W?denswil
Country:SWITZERLAND
Email:andrea.patocchi@acw.admin.ch
Phone:+41 44 783 6313
Fax:+41 (0)44 783 63 05
Andreas Peil
First name:Andreas
Last name:Peil
Title:Researcher
Institution:Institute for Breeding Research on Fruit
Address:Kulius Kuhn-Institut (JKI), Pillnitzer Platz 3a, 01326
Country:Dresden, Germany
Email:andreas.peil@jki.bund.de
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
primer 1Hi23g12.primer 1Malus x domesticaprimer
primer 2Hi23g12.primer 2Malus x domesticaprimer


This genetic_marker is adjacent to the following QTL feature(s):

Feature NameUnique NameSpeciesType
fruit lengthqFRL.JGD-J8.2008Malus x domesticaQTL


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
Hi23g12Hi23g12-65.3Malus x domesticamarker_locus
Hi23g12Hi23g12-41.8Malus x domesticamarker_locus
Hi23g12Hi23g12Malus x domesticamarker_locus
Hi23g12-1_SGHi23g12-1_SGMalus x domesticamarker_locus
Hi23g12.zHi23g12.zMalus x domesticamarker_locus


Publications
YearPublication
2006Silfverberg-Dilworth E, Matasci CL, Van de Weg WE, Van Kaauwen MPW, Walser M, Kodde LP, Soglio V, Gianfranceschi L, Durel CE, Costa F, Yamamoto T, Koller B, Gessler C Patocchi A. Microsatellite markers spanning the apple (Malus x domestica Borkh.) genome. Tree Genetics and Genomes. 2006; 2(4):202-224.
2014Wöhner TW, Flachowsky H, Richter K, Garcia-Libreros T, Trognitz F, Hanke M, Peil A. QTL mapping of fire blight resistance in Malus ×robusta 5 after inoculation with different strains of Erwinia amylovora. Molecular breeding. 2014; 34(1):217-230.
2012Schouten HJ, van de Weg WE, Carling J, Khan SI, McKay SJ, van Kaauwen MPW, Wittenberg AHJ, Koehorst-van Putten HJJ, Noordijk Y, Gao Z, Rees DJG, Van Dyk MM, Jaccoud D, Considine MJ, Kilian A. Diversity arrays technology (DArT) markers in apple for genetic linkage maps. Molecular breeding 2012 29:645–660
2012Antanaviciute L, Fernández-Fernández F, Jansen J, Banchi E, Evans KM, Viola R, Velasco R, Dunwell JM, Troggio M, Sargent DJ. Development of a dense SNP-based linkage map of an apple rootstock progeny using the Malus Infinium whole genome genotyping array. BMC genomics. 2012; 13:203.
2015Ben Sadok I, Tiecher A, Galvez-Lopez D, Lahaye M, Lasserre-Zuber P, Bruneau M, Hanteville S, Robic R, Cournol R, Laurens F. Apple fruit texture QTLs: year and cold storage effects on sensory and instrumental traits. Tree Genetics & Genomes 2015 11:119
2002Liebhard, R., Gianfranceschi, L., Koller, B., Ryder, C.D., Tarchini, R., Weg, E. van de., Gessler, C. Development and characterisation of 140 new microsatellites in apple (Malus x domestica Borkh.) Mol. breed. 2002. v. 10 (4) p. 217-241.
2004Plant Breeding, 123(4):321
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Apple-JM7xS63-F1J15N/A65.3Hi23g12-65.3View
2Apple-JM7xS63-F1S8N/A41.8Hi23g12-41.8View
3Apple-FD-F1-2006D8N/A61.7Hi23g12View
4Apple-IM-F1-IdaredIda LG 15N/A84.8Hi23g12View
5Apple-IM-F1-Mr5Mr5 LG 8N/A38.3Hi23g12View
6Apple-2000-2012-F1ch15N/A106Hi23g12View
7Apple-X3259X3263-F18N/A73.67Hi23g12View
8Apple-RGxPI6-F1LG15N/A99.7Hi23g12View
9Apple-SG-F18N/A48.4Hi23g12-1_SGView
10Apple-MM-F18N/A60.8Hi23g12.zView
11Apple-M432-2012LG8N/A54Hi23g12.zView