AAT, AAT (gene) Prunus mume

Gene Overview
Name AAT
Gene Symbol AAT
Type gene
Organism Prunus mume
Synonym alcohol acyl-transferase
Alcohol acyl-transferase
pPmAAT
Pm94
Description NA
Comment ester
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
alcohol acyl transferaseAATPrunus mumegene_class


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
AATAB499126.1-AAT.m1Prunus mumemRNA
AATAB218791.1-AAT.m1Prunus mumemRNA


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
mRNA parsed from NCBI nr database AB499126.1-AAT.m1 scaffold_3:7062431..7062764
AB499126.1
mRNA parsed from NCBI nr database AB218791.1-AAT.m1 N/A AB218791.1

Sequence(s):
>AB499126.1-AAT.m1334
tagccgcattcatgattctttggttcgtatggatgataactatcttagatcggctctagactatcttgagcttcagcctg
atctgtcagcccttgttcgcggtgctcattcttttaggtgccctaatcttgggataactagctgggttaggctgccgatc
catgatgctgactttggttggggtcgacccattttcatgggacctggtggaattgcatttgaggggctggctttcgtaat
accaagtgcaactaatgatgggagtttatcagtggccatatctcttcaatctgaacatatgaaatcattttccaagttgt
tatacgacatataa
back to top
>AB218791.1-AAT.m11317
atggtggtcaacgtgagcgtgagggagacaacgctggttaagccggcggcggagacgccgaggaaggcgctgtggaactc
taacgtggacctggtgatcccgagcatccacacgcccagcgtctacttctacaggcccaaccaaaacggtgcgtcgtcga
acttcttcgacccggcggtgctcaagctcgccctgtccaaggccctcgtgcccttctaccccatggccggtcgcctcaag
cgcgacgacgacggccgtatcgagatcgactgcaacggggaaggggtgctgtttgtcgaggccgagacgagctcggtcat
cgatgatttcggcgattttgcgccgactctcgagctccggaggctcatccccgccgttgattactccgctgggatatcct
catatgctctcttggtgttacaggtcacatacttcaaatgtggaggagtgtcccttggtgttggaatgcagcatcatgca
gcagatggattttctggtctccactttgtcaacacatggtctgatatggctcgcggccttgatcttacacttccgccgtt
cattgacaggacattacttcgtgcccgagatccaccgcagcctgcattccaccacatcgagtaccaacctgctccaccat
tgaaaacccctctgcaaagcacaaaacctggcgctgatagcacaacagtctccatttttagattgacgcgggagcagctc
aacatcttgaaagccaagtccaaggaagctgggaacacaatcagctatagctcatatgagatgatggcgggtcatatttg
gagatgtgtatgcaaggcacgcgaacttcccaatgatcaagacaccaaactatatattgccactgatggaagatccagac
tgcaacccccactccctcctggttactttggcaatgtgattttcacagcaacacccattgctgtcgcaggggatctccaa
tcaaaaccaacatggttcgcagcaagccgcattcatgattctttggttcgtatggatgataactatcttagatcggctct
agactatcttgagcttcagcctgatctgtcagcccttgttcgcggtgctcattcttttaggtgccctaatcttgggataa
ctagctgggttaggctgccgatccatgatgctgactttggttggggtcgacccattttcatgggacctggtggaattgca
tttgaggggctggctttcgtaataccaagtgcaactaatgatgggagtttatcagtggccatatctcttcaatctgaaca
tatgaaatcattttccaagttgttatacgacatataa
back to top