ACO-2, ACO-2 (gene) Eriobotrya japonica

Gene Overview
Name ACO-2
Gene Symbol ACO-2
Type gene
Organism Eriobotrya japonica
Synonym 1-aminocyclopropane-1-carboxylate oxidase
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
1-aminocyclopropane-1-carboxylate oxidaseACOEriobotrya japonicagene_class


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
ACO-2GQ457295.1-ACO-2.m1Eriobotrya japonicamRNA


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
mRNA parsed from NCBI nr database GQ457295.1-ACO-2.m1 N/A GQ457295.1

Sequence(s):
>GQ457295.1-ACO-2.m1774
tgagctgatggacactgtggagaggcttacaaaagagcactaccggcagtgtttggagcaaaggttcaaggagttggtgg
ccagcaaaggccttgaggctgttcagacagaagtcaacgatatggattgggaaagcactttctacttgcgccatcttcct
caatccaacatatctcaagtcccagatctcaaggatgagtacaggaatgtgatgaaggagtttgcattgaaactggagaa
attagcagagcagctgctggacttgttgtgtgagaatcttggattggaacaagggtaccttaagaaggcattttatggaa
caaatggaccaacttttggcaccaaggttagcaactaccctccatgtcccaacaatgacaagatcaagggtctccgggcc
cacaccgatgccggcggcctcatcttgctcttccaggatgacaaggtcagtggcctccagctcctcaaggacggagagtg
ggttgatgtgcctcccatgcgccactcccttgttatcaaccttggcgaccaacttgaggtgatcaccaatggaaagtata
agagtgtggagcacagagtgattgcccaaacagatggaaccagaatgtcaatagcttcattctacaacccaagcagtgat
gcagtgatctacccagcaccaaccctagtggagaaaaaggcagaggagaagaatcaagtgtacccgaaattcgtgttcga
agactacatgaagcactatgctggtgtcaagttccaggccaaggagccaagatt
back to top