ACO1, ACO1 (gene) Malus x domestica

Gene Overview
Name ACO1
Gene Symbol ACO1
Type gene
Organism Malus x domestica
Synonym ACC oxidase
ACO1_2
1-aminocyclopropane-1-carboxylate oxidase
Description NA
Comment MdACO1
MdACO1_2
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
ACO1JQ675681.1-ACO1Malus x domesticagene
ACO1JQ675680.1-ACO1Malus x domesticagene
ACO1JQ675679.1-ACO1Malus x domesticagene
ACO1DQ439791.1-ACO1Malus x domesticagene
ACO1AY598768.1-ACO1Malus x domesticagene
ACO1AY598767.1-ACO1Malus x domesticagene
ACO1AY598766.1-ACO1Malus x domesticagene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
ACO1JQ675681.1-ACO1.m1Malus x domesticamRNA
ACO1JQ675680.1-ACO1.m1Malus x domesticamRNA
ACO1JQ675679.1-ACO1.m1Malus x domesticamRNA
ACO1DQ439792.1-ACO1.m1Malus x domesticamRNA
ACO1DQ439791.1-ACO1.m1Malus x domesticamRNA
ACO1AY598768.1-ACO1.m1Malus x domesticamRNA
ACO1AY598767.1-ACO1.m1Malus x domesticamRNA
ACO1AY598766.1-ACO1.m1Malus x domesticamRNA
ACO1DQ137850.1-ACO1.m1Malus x domesticamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
1-aminocyclopropane-1-carboxylate oxidaseACOMalus x domesticagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
predicted genes from whole genome assembly JQ675681.1-ACO1 Chr10:40754977..40756570
chr10:32199173..32200766
chr10:36882793..36884386
JQ675681.1
predicted genes from whole genome assembly JQ675680.1-ACO1 Chr10:40754977..40756572
chr10:32199171..32200766
chr10:36882793..36884388
JQ675680.1
predicted genes from whole genome assembly JQ675679.1-ACO1 Chr10:40754977..40756572
chr10:32199171..32200766
chr10:36882793..36884388
JQ675679.1
predicted genes from whole genome assembly DQ439791.1-ACO1 Chr10:40755746..40756549
chr10:32199194..32199997
chr10:36883562..36884365
DQ439791.1
predicted genes from whole genome assembly AY598768.1-ACO1 Chr10:40756006..40756566
chr10:32199177..32199737
chr10:36883822..36884382
AY598768.1
predicted genes from whole genome assembly AY598767.1-ACO1 Chr10:40756006..40756566
chr10:32199177..32199737
chr10:36883822..36884382
AY598767.1
predicted genes from whole genome assembly AY598766.1-ACO1 Chr10:40756006..40756566
chr10:32199177..32199737
chr10:36883822..36884382
AY598766.1
predicted genes from whole genome assembly JQ675681.1-ACO1.m1 Chr10:40754977..40756570
chr10:32199173..32200766
chr10:36882793..36884386
JQ675681.1
predicted genes from whole genome assembly JQ675680.1-ACO1.m1 Chr10:40754977..40756572
chr10:32199171..32200766
chr10:36882793..36884388
JQ675680.1
predicted genes from whole genome assembly JQ675679.1-ACO1.m1 Chr10:40754977..40756572
chr10:32199171..32200766
chr10:36882793..36884388
JQ675679.1
predicted genes from whole genome assembly DQ439792.1-ACO1.m1 Chr10:40756363..40756594
chr10:32199149..32199380
chr10:36884179..36884410
DQ439792.1
predicted genes from whole genome assembly DQ439791.1-ACO1.m1 Chr10:40755746..40756549
chr10:32199194..32199997
chr10:36883562..36884365
DQ439791.1
predicted genes from whole genome assembly AY598768.1-ACO1.m1 Chr10:40756006..40756566
chr10:32199177..32199737
chr10:36883822..36884382
AY598768.1
predicted genes from whole genome assembly AY598767.1-ACO1.m1 Chr10:40756006..40756566
chr10:32199177..32199737
chr10:36883822..36884382
AY598767.1
predicted genes from whole genome assembly AY598766.1-ACO1.m1 Chr10:40756006..40756566
chr10:32199177..32199737
chr10:36883822..36884382
AY598766.1
predicted genes from whole genome assembly DQ137850.1-ACO1.m1 Chr10:40754956..40756594
chr10:32199149..32200787
chr10:36882772..36884410
DQ137850.1

Sequence(s):
>JQ675681.1-ACO11593
gacttgagccttgtcaatggtgaagagagagcagcaaccttggagaagatcaatgatgcttgtgagaactggggtttctt
tgaggtaacccaacaagctgtgagatcttttatttttatccctcctcgaggcaccaactagacgtccgcccctcgtgtgc
ttagaggggaaatctgtaaagtaaatctgtctctaagcgcaagagggtcggaaaacaaatgcgccgccctagttgctcag
ttttatggtgctgcgttagtttctgtagaaatatgacatttctatgtgtttctaactcttttgtgtgtaaataactgaag
ctggtgaaccatgggatgtctactgagcttttggacactgtggagaagatgaccaaggatcactacaagaagaccatgga
gcaaaggtttaaggaaatggtggcagccaaaggcctcgacgatgtccagtccgaaatccacgacttggactgggaaagca
ccttcttcttgcgccaccttccttcctcaaacatttccgaaatccctgatctcgaggaagattacaggtcacacactaat
cacaacaagcttaattaattttccacatacttgggctttgtcaagttggctagagcacccgtgcggcccctcgttgcact
taagttcgaatctcctccatgtaggttagattgtattagaatatcgtattgattttcttgtatttattttgaacgatatt
tcaggaagaccatgaaggaatttgcagtggaactggagaagctagctgagaagcttttggacttgctgtgtgagaatctt
ggactcgagaagggttatctgaagaaggttttctatggatccaagggtccgaattttgggaccaaggtcagcaactaccc
tccatgccccaagccagacctgatcaagggactccgggcccacagcgacgccggtggcatcatcctgcttttccaggatg
acaaggtcagcggcctccagcttctcaaggatggtgaatgggtggatgtccccccaatgcaccactccattgtcataaac
ttaggtgaccagattgaggtataccagttacccgactacccattttttatggaacggaggtccgatgtgtcatcaatatg
tattgatatcattgtcgtcaacaaaacttacatacatgttaccaatacatttcaattctcgaccaatatataatgaagag
cggacgtcatgcacatatagctagtactttcgctatcaagtttactgaatcgtatacttttaattatttgatgcacatat
aactagtactttcgctatcaagtttactgaatcgtatacttttaattatttgatgcaggtgatcaccaatgggaagtaca
aaagtgtgatgcaccgggtgatagctcagtcggatgggaccagaatgtcgatagcctcgttctacaacccaggcaacgac
tcattcatcagcccagcaccggcagtgcttgagaagaaaactgaggacgcccaaacttatcccaagtttgtgtttgatga
ctacatgaagctgtattctggcctgaaatttcaagccaaggagccaagatttgaagctatgaaggccaaggaa
back to top
>JQ675680.1-ACO11533
gacttgagccttgtcaatggtgaagagagagcagcaaccttggagaagatcaatgatgcttgtgagaactggggtttctt
tgaggtaacccaacaagctgtgagatcttttatttttatccctcctcgaggcaccaactagacgtccgcccctcgtgtgc
ttagaggggaaatctgtaaagtaaatctgtctctaagcgcaagagggtcggaaaacaaatgcgccgccctagttgctcag
ttttatggtgctgcgttagtttctgtagaattatgacatttctatgtgtttctaactcttttgtgtgtaaataactgaag
ctggtgaaccatgggatgtctactgagcttttggacactgtggagaagatgaccaaggatcactacaagaagaccatgga
gcaaaggtttaaggaaatggtggcagccaaaggcctcgacgatgtccagtccgaaatccacgacttggactgggaaagca
ccttcttcttgcgccaccttccttcctcaaacatttccgaaatccctgatctcgaggaagattacaggtcacacactaat
cacaacaagcttaattaattttccacttacttgggctttgtcaagttggctagagcacccgtgcggcccctcgttgcact
taagttcgaatctcctccatgtaggttagattgtattagaatatcgtattgattttcttgtatttattttgaacgatatt
tcaggaagaccatgaaggaatttgcagtggaactggagaagctagctgagaagcttttggacttgctgtgtgagaatctt
ggactcgagaagggttatctgaagaaggttttctatggatccaagggtccgaattttgggaccaaggtcagcaactaccc
tccatgccccaagccagacctgatcaagggactccgggcccacagcgacgccggtggcatcatcctgcttttccaggatg
acaaggtcagcggcctccagcttctcaaggatggtgaatgggtggatgtccccccaatgcaccactccattgtcataaac
ttaggtgaccagattgaggtataccagttacccgactacccattttttatggaacggaagtccgatgtgtcatcaatatg
tattgatatcattgtcgtcaacaaaacttacatacatgttaccaatacatttcaattctcgaccaatatataatgaagag
cggacgtcatgcacatataactagtactttcgctatcaagtttactgaatcgtatacttttaattatttgatgcaggtga
tcaccaatgggaagtacaaaagtgtgatgcaccgggtgatagctcagtcggatgggaccagaatgtcgatagcctcgttc
tacaacccaggcaacgacgcattcatcagcccagcaccggcagtgcttgagaagaaaactggggacgccccaacttatcc
caagtttgtgtttgatgactacatgaagctgtattctggcctgaaattccaagccaaggagccaagatttgaagctatga
aggccaaggaatc
back to top
>JQ675679.1-ACO11594
gacttgagccttgtcaatggtgaagagagagcagcaaccttggagaagatcaatgatgcttgtgagaactggggtttctt
tgaggtaacccaacaagctgtgagatcttttatttttatccctcctcgaggcaccaactagacgtccgcccctcgtgtgc
ttagaggggaaatctgtaaagtaaatctgtctctaagcgcaagagggtcggaaaacaaatgcgccgccctagttgctcag
ttttatggtgctgcgttagtttctgtagaattatgacatttctatgtgtttctaactcttttgtgtgtaaataactgaag
ctggtgaaccatgggatgtctactgagcttttggacactgtggagaagatgaccaaggatcactacaagaagaccatgga
gcaaaggtttaaggaaatggtggcagccaaaggcctcgacgatgtccagtccgaaatccacgacttggactgggaaagca
ccttcttcttgcgccaccttccttcctcaaacatttccgaaatccctgatctcgaggaagagtacaggtcacacactaat
cacaacaagcttaattaattttccacatacttgggcttagtcaggttggctagagcacccgtgcggcccctcgttgcact
taagttcgaatctcctccatgtaggttagattgtattagaatatcttattgattttcttgtatttattttgaacgatatt
tcaggaagaccatgaaggaatttgcagtggaactggagaagctagctgagaagcttttggacttgctgtgtgagaatctt
ggactcgagaagggttatctggagaaggttttctatggatccaagggtccgaattttgggaccaaggtcagcaactaccc
tccatgccccaagccagacctgatcaagggactccgggcccacagcgacgccggtggcatcatcctgcttttccaggatg
acaaggtcagcggcctccagcttctcaaggatggtgaatgggtggatgtccccccaatgcaccactccattgtcataaac
ttaggtgaccagattgaggtataccagttacccgactacccattttttatggaacggaagtctgatgtgtcatcaatatg
tattgatatcattgcgtcaacaaaacttacatacatgttaccaatacatttcaattctcgaccaatatataatgaagagc
ggacgtcatgcacatataactagtacttttgctatcaagtttactgaatcgtatacttttaattatttgatgcacatata
actagtactttcgctatcaagtttactgaatcgtatacttttaattatttgatgcaggtgatcaccaatgggaagtacaa
aagtgtgatgcaccgggtgatagctcagtcggatgggaccagaatgtcgatagcctcgttctacaacccaggcaacgact
cattcatcagcccagcaccggcagtgcttgagaagaaaactgaggacgccccaacttatcccaagtttgtgtttgatgac
tacatgaagctgtattctggcctgaaattccaagccaaggagccaagatttgaagctatgaaggccaaggaatc
back to top
>DQ439791.1-ACO1803
gaagcttttggacttgctgtgtgagaatcttggactcgagaagggttatctgaagaaggttttctatggatccaagggtc
cgaattttgggaccaaggtcagcaactaccctccatgccccaagccagacctgatcaagggactccgggcccacagcgac
gccggtggcatcatcctgcttttccaggatgacaaggtcagcggcctccagcttctcaaggatggtgaatgggtggatgt
ccccccaatgcaccactccattgtcataaacttaggtgaccagattgaggtataccagttacccgactacccatttttta
tggaacggaagtccgatgtgtcatcaatatgtattgatatcattgtcgtcaacaaaacttacatacatgttaccaataca
tttcaattctcgaccaatatataatgaagagcagacgtcatgcacatataactagtactttcgctatcaagtttactgaa
tcgtatacttttaattatttgatgcacatataactagtactttcgctatcaagtttactgaatcgtatacttttaattat
ttgatgcaggtgatcaccaatgggaagtacaaaagtgtgatgcaccgggtgatagctcagtcggatgggaccagaatgtc
gatagcctcgttctacaacccaggcaacgactcattcatcagcccagcaccggcagtgcttgagaagaaaactgaggacg
ccccaacttatcccaagtttgtgtttgatgactacatgaagctgtattctggcctgaaattccaagccaaggagccaaga
ttt
back to top
>AY598768.1-ACO1498
ttgtcataaacttaggtgaccagattgaggtataccagttacccgactacccattttttatggaacggaagtccgatgtg
tcatcaatatgtattgatatcattgtcgtcaacaaaacttacatacatgttaccaatacatttcaattctcgaccaatat
ataatgaagagcggacgtcatgcacatataactagtactttcgctatcaagtttactgaatcgtatacttttaattattt
gatgcaggtgatcaccaatgggaagtacaaaagtgtgatgcaccgggtgatagctcagtcggatgggaccagaatgtcga
tagcctcgttctacaacccaggcaacgacgcattcatcagcccagcaccggcagtgcttgagaagaaaactggggacgcc
ccaacttatcccaagtttgtgtttgatgactacatgaagctgtattctggcctgaaattccaagccaaggagccaagatt
tgaagctatgaaggccaa
back to top
>AY598767.1-ACO1560
ttgtcataaacttaggtgaccagattgaggtataccagttacccgactacccattttttatggaacggaagtctgatgtg
tcatcaatatgtattgatatcattgtcgtcaacaaaacttacatacatgttaccaatacatttcaattctcgaccaatat
ataatgaagagcggacgtcatgcacatataactagtacttttgctatcaagtttactgaatcgtatacttttaattattt
gatgcacatataactagtactttcgctatcaagtttactgaatcgtatacttttaattatttgatgcaggtgatcaccaa
tgggaagtacaaaagtgtgatgcaccgggtgatagctcagtcggatgggaccagaatgtcgatagcctcgttctacaacc
caggcaacgactcattcatcagcccagcaccggcagtgcttgagaagaaaactggggacgccccaacttatcccaagttt
gtgtttgatgactacatgaagctgtattctggcctgaaattccaagccaaggagccaagatttgaagctatgaaggccaa
back to top
>AY598766.1-ACO1498
ttgtcataaacttaggtgaccagattgaggtataccagttacccgactacccattttttatggaacggaagtccgatgtg
tcatcaatatgtattgatatcattgtcgtcaacaaaacttacatacatgttaccaatacatttcaattctcgaccaatat
ataatgaagagcggacgtcatgcacatataactagtactttcgctatcaagtttactgaatcgtatacttttaattattt
gatgcaggtgatcaccaatgggaagtacaaaagtgtgatgcaccgggtgatagctcagtcggatgggaccagaatgtcga
tagcctcgttctacaacccaggcaacgacgcattcatcagcccagcaccggcagtgcttgagaagaaaactggggacgcc
ccaacttatcccaagtttgtgtttgatgactacatgaagctgtattctggcctgaaattccaagccaaggagccaagatt
tgaagctatgaaggccaa
back to top
>JQ675681.1-ACO1.m1900
gacttgagccttgtcaatggtgaagagagagcagcaaccttggagaagatcaatgatgcttgtgagaactggggtttctt
tgagctggtgaaccatgggatgtctactgagcttttggacactgtggagaagatgaccaaggatcactacaagaagacca
tggagcaaaggtttaaggaaatggtggcagccaaaggcctcgacgatgtccagtccgaaatccacgacttggactgggaa
agcaccttcttcttgcgccaccttccttcctcaaacatttccgaaatccctgatctcgaggaagattacaggaagaccat
gaaggaatttgcagtggaactggagaagctagctgagaagcttttggacttgctgtgtgagaatcttggactcgagaagg
gttatctgaagaaggttttctatggatccaagggtccgaattttgggaccaaggtcagcaactaccctccatgccccaag
ccagacctgatcaagggactccgggcccacagcgacgccggtggcatcatcctgcttttccaggatgacaaggtcagcgg
cctccagcttctcaaggatggtgaatgggtggatgtccccccaatgcaccactccattgtcataaacttaggtgaccaga
ttgaggtgatcaccaatgggaagtacaaaagtgtgatgcaccgggtgatagctcagtcggatgggaccagaatgtcgata
gcctcgttctacaacccaggcaacgactcattcatcagcccagcaccggcagtgcttgagaagaaaactgaggacgccca
aacttatcccaagtttgtgtttgatgactacatgaagctgtattctggcctgaaatttcaagccaaggagccaagatttg
aagctatgaaggccaaggaa
back to top
>JQ675680.1-ACO1.m1902
gacttgagccttgtcaatggtgaagagagagcagcaaccttggagaagatcaatgatgcttgtgagaactggggtttctt
tgagctggtgaaccatgggatgtctactgagcttttggacactgtggagaagatgaccaaggatcactacaagaagacca
tggagcaaaggtttaaggaaatggtggcagccaaaggcctcgacgatgtccagtccgaaatccacgacttggactgggaa
agcaccttcttcttgcgccaccttccttcctcaaacatttccgaaatccctgatctcgaggaagattacaggaagaccat
gaaggaatttgcagtggaactggagaagctagctgagaagcttttggacttgctgtgtgagaatcttggactcgagaagg
gttatctgaagaaggttttctatggatccaagggtccgaattttgggaccaaggtcagcaactaccctccatgccccaag
ccagacctgatcaagggactccgggcccacagcgacgccggtggcatcatcctgcttttccaggatgacaaggtcagcgg
cctccagcttctcaaggatggtgaatgggtggatgtccccccaatgcaccactccattgtcataaacttaggtgaccaga
ttgaggtgatcaccaatgggaagtacaaaagtgtgatgcaccgggtgatagctcagtcggatgggaccagaatgtcgata
gcctcgttctacaacccaggcaacgacgcattcatcagcccagcaccggcagtgcttgagaagaaaactggggacgcccc
aacttatcccaagtttgtgtttgatgactacatgaagctgtattctggcctgaaattccaagccaaggagccaagatttg
aagctatgaaggccaaggaatc
back to top
>JQ675679.1-ACO1.m1902
gacttgagccttgtcaatggtgaagagagagcagcaaccttggagaagatcaatgatgcttgtgagaactggggtttctt
tgagctggtgaaccatgggatgtctactgagcttttggacactgtggagaagatgaccaaggatcactacaagaagacca
tggagcaaaggtttaaggaaatggtggcagccaaaggcctcgacgatgtccagtccgaaatccacgacttggactgggaa
agcaccttcttcttgcgccaccttccttcctcaaacatttccgaaatccctgatctcgaggaagagtacaggaagaccat
gaaggaatttgcagtggaactggagaagctagctgagaagcttttggacttgctgtgtgagaatcttggactcgagaagg
gttatctggagaaggttttctatggatccaagggtccgaattttgggaccaaggtcagcaactaccctccatgccccaag
ccagacctgatcaagggactccgggcccacagcgacgccggtggcatcatcctgcttttccaggatgacaaggtcagcgg
cctccagcttctcaaggatggtgaatgggtggatgtccccccaatgcaccactccattgtcataaacttaggtgaccaga
ttgaggtgatcaccaatgggaagtacaaaagtgtgatgcaccgggtgatagctcagtcggatgggaccagaatgtcgata
gcctcgttctacaacccaggcaacgactcattcatcagcccagcaccggcagtgcttgagaagaaaactgaggacgcccc
aacttatcccaagtttgtgtttgatgactacatgaagctgtattctggcctgaaattccaagccaaggagccaagatttg
aagctatgaaggccaaggaatc
back to top
>DQ439792.1-ACO1.m1231
cagtcggatgggaccagaatgtcgatagcctcgttctacaacccaggcaacgactcattcatcagcccagcaccggcagt
gcttgagaagaaaactgaggacgccccaacttatcccaagtttgtgtttgatgactacatgaagctgtattctggcctga
aattccaagccaaggagccaagatttgaagctatgaaggccaaggaatccacccctgttgcaactgcctga
back to top
>DQ439791.1-ACO1.m1523
gaagcttttggacttgctgtgtgagaatcttggactcgagaagggttatctgaagaaggttttctatggatccaagggtc
cgaattttgggaccaaggtcagcaactaccctccatgccccaagccagacctgatcaagggactccgggcccacagcgac
gccggtggcatcatcctgcttttccaggatgacaaggtcagcggcctccagcttctcaaggatggtgaatgggtggatgt
ccccccaatgcaccactccattgtcataaacttaggtgaccagattgaggtgatcaccaatgggaagtacaaaagtgtga
tgcaccgggtgatagctcagtcggatgggaccagaatgtcgatagcctcgttctacaacccaggcaacgactcattcatc
agcccagcaccggcagtgcttgagaagaaaactgaggacgccccaacttatcccaagtttgtgtttgatgactacatgaa
gctgtattctggcctgaaattccaagccaaggagccaagattt
back to top
>AY598768.1-ACO1.m1280
ttgtcataaacttaggtgaccagattgaggtgatcaccaatgggaagtacaaaagtgtgatgcaccgggtgatagctcag
tcggatgggaccagaatgtcgatagcctcgttctacaacccaggcaacgacgcattcatcagcccagcaccggcagtgct
tgagaagaaaactggggacgccccaacttatcccaagtttgtgtttgatgactacatgaagctgtattctggcctgaaat
tccaagccaaggagccaagatttgaagctatgaaggccaa
back to top
>AY598767.1-ACO1.m1280
ttgtcataaacttaggtgaccagattgaggtgatcaccaatgggaagtacaaaagtgtgatgcaccgggtgatagctcag
tcggatgggaccagaatgtcgatagcctcgttctacaacccaggcaacgactcattcatcagcccagcaccggcagtgct
tgagaagaaaactggggacgccccaacttatcccaagtttgtgtttgatgactacatgaagctgtattctggcctgaaat
tccaagccaaggagccaagatttgaagctatgaaggccaa
back to top
>AY598766.1-ACO1.m1280
ttgtcataaacttaggtgaccagattgaggtgatcaccaatgggaagtacaaaagtgtgatgcaccgggtgatagctcag
tcggatgggaccagaatgtcgatagcctcgttctacaacccaggcaacgacgcattcatcagcccagcaccggcagtgct
tgagaagaaaactggggacgccccaacttatcccaagtttgtgtttgatgactacatgaagctgtattctggcctgaaat
tccaagccaaggagccaagatttgaagctatgaaggccaa
back to top
>DQ137850.1-ACO1.m1942
atggcgactttcccagttgttgacttgagccttgtcaatggtgaagagagagcagcaaccttggagaagatcaatgatgc
ttgtgagaactggggtttctttgagctggtgaaccatgggatgtctactgagcttttggacactgtggagaagatgacca
aggatcactacaagaagaccatggagcaaaggtttaaggaaatggtggcagccaaaggcctcgacgatgtccagtccgaa
atccacgacttggactgggaaagcaccttcttcttgcgccaccttccttcctcaaacatttccgaaatccctgatctcga
ggaagagtacaggaagaccatgaaggaatttgcagtggaactggagaagctagctgagaagcttttggacttgctgtgtg
agaatcttggactcgagaagggttatctgaagaaggttttctatggatccaagggtccgaattttgggaccaaggtcagc
aactaccctccatgccccaagccagacctgatcaagggactccgggcccacagcgacgccggtggcatcatcctgctttt
ccaggatgacaaggtcagcggcctccagcttctcaaggatggtgaatgggtggatgtccccctaatgcaccagctaactc
acatcttaggtgaccagattgaggtgatcaccaatgggaagtacaaaagtgtgatgcaccgggtgatagctcagtcggat
gggaccagaatgtcgatagcctcgttctacaacccaggcaacgactcattcatcagcccagcaccggcagtgcttgagaa
gaaaactgaggacgccccaacttatcccaagtttgtgtttgatgactacatgaagctgtattctggcctgaaattccaag
ccaaggagccaagatttgaagctatgaaggccaaggaatccacccctgttgcaactgcctga
back to top