ACO1, ACO1 (gene) Malus floribunda

Gene Overview
Name ACO1
Gene Symbol ACO1
Type gene
Organism Malus floribunda
Synonym 1-aminocyclopropane-1-carboxylate oxidase
Description NA
Comment involved in the ethylene biosynthetic pathway
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
ACO1KJ206336.1-ACO1Malus floribundagene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
ACO1KJ206336.1-ACO1.m1Malus floribundamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
1-aminocyclopropane-1-carboxylate oxidaseACOMalus floribundagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
predicted genes from whole genome assembly KJ206336.1-ACO1 Chr10:40754977..40756572
chr10:32199171..32200766
chr10:36882793..36884388
KJ206336.1
predicted genes from whole genome assembly KJ206336.1-ACO1.m1 Chr10:40754977..40756572
chr10:32199171..32200766
chr10:36882793..36884388
KJ206336.1

Sequence(s):
>KJ206336.1-ACO11532
gacttgagccttgtcaatggtgaagagagagcagcaaccttggagaagatcaatgatgcttgtgagaactggggtttctt
tgaggtaacccaacaagctgtgagatcttttatttttatccctcctcgaggcaccaactagacgtccgcccctcgtgtgc
ttagaggggaaactgtaaagtaaatctgtctctaagcgcaagagggtcggaaaacaaatgtgccgccctagttgctcagt
tttatggtactgcgttagtttctgtagaattatgacatttctatgtgtttctaactcttttgtgtgtaaataactgaagc
tggtgaaccatgggatgtctactgagcttttggacactgtggagaggatgaccaaggatcactacaagaagaccatggag
caaaggtttaaggaaacggtggcagccaaaggcctcgacgatgtccagtccgaaatccacgacttggactgggaaagcac
cttcttcttgcgccaccttccttcctcaaacatttccgaaatccctgatctggaggaagattacaggtcacacactaatc
acaacaagcttaattaattttccacatacttgggcttagtcaagttggctagagcacccgtgcggcccctcgttgcactt
aagttcaaatctcctccatgtagattagattgtattagaatatcgtattgattttcttgtatttattttgaacgatattt
caggaagaccatgaaggaatttgcagtggaactggagaagctagctgagaagcttttggacttgctgtgtgagaatcttg
gactcgagaagggttatctgaagaaggttttctatggatccaagggtccgaattttgggaccaaggtcagcaactaccct
ccatgccccaagccagacctgatcaagggactccgggcccacagcgacgccggtggcatcatcctgcttttccaggatga
caaggtcagcggcctccagcttctcaaggatgatgaatgggtggatgtccccccaatgcaccactccattgtcataaact
taggtgaccagattgaggtataccagttacccgactacccatttttttatggaacggaagtccgatgtgtcatcaatatg
tattgatatcattgtcgtcaacaaaacttacagacatgttaccaatacatttcaacgctcgaccaatttataatgaagag
cggacgtcatgcacatataactaatactttcgctatcaagtttactgaatcgtagactttaattatttgacgcaggtgat
ctcgaatgggaagtacaaaagtgtgatgcaccgggtgatagcgcagtcggatgggaccagaatgtcgatagcctcgttct
acaacccaggcaacgacgcattcatcagcccagcaccggcagtgcttgagaagaaaactggggacgccccaacttatccc
aagtttgtgtttgatgactacatgaagctgtattctggcctgaaattccaagccaaggagccaagatttgaagctatgaa
ggccaaggaatc
back to top
>KJ206336.1-ACO1.m1902
gacttgagccttgtcaatggtgaagagagagcagcaaccttggagaagatcaatgatgcttgtgagaactggggtttctt
tgagctggtgaaccatgggatgtctactgagcttttggacactgtggagaggatgaccaaggatcactacaagaagacca
tggagcaaaggtttaaggaaacggtggcagccaaaggcctcgacgatgtccagtccgaaatccacgacttggactgggaa
agcaccttcttcttgcgccaccttccttcctcaaacatttccgaaatccctgatctggaggaagattacaggaagaccat
gaaggaatttgcagtggaactggagaagctagctgagaagcttttggacttgctgtgtgagaatcttggactcgagaagg
gttatctgaagaaggttttctatggatccaagggtccgaattttgggaccaaggtcagcaactaccctccatgccccaag
ccagacctgatcaagggactccgggcccacagcgacgccggtggcatcatcctgcttttccaggatgacaaggtcagcgg
cctccagcttctcaaggatgatgaatgggtggatgtccccccaatgcaccactccattgtcataaacttaggtgaccaga
ttgaggtgatctcgaatgggaagtacaaaagtgtgatgcaccgggtgatagcgcagtcggatgggaccagaatgtcgata
gcctcgttctacaacccaggcaacgacgcattcatcagcccagcaccggcagtgcttgagaagaaaactggggacgcccc
aacttatcccaagtttgtgtttgatgactacatgaagctgtattctggcctgaaattccaagccaaggagccaagatttg
aagctatgaaggccaaggaatc
back to top