ACO1, ACO1 (gene) Prunus persica

Gene Overview
Name ACO1
Gene Symbol ACO1
Type gene
Organism Prunus persica
Synonym 1-aminocyclopropane-1-carboxylate oxidase
1-aminocyclopropane 1-carboxylic acid oxidase
PP-ACO1
PAO1
Description NA
Comment PpACO1
ACO1; ethylene forming enzyme EFE
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
ACO1AF532976.1-ACO1Prunus persicagene
ACO1AF129073.1-ACO1Prunus persicagene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
ACO1JX876855.1-ACO1.m1Prunus persicamRNA
ACO1JX876854.1-ACO1.m1Prunus persicamRNA
ACO1JX876853.1-ACO1.m1Prunus persicamRNA
ACO1JX876852.1-ACO1.m1Prunus persicamRNA
ACO1JX876851.1-ACO1.m1Prunus persicamRNA
ACO1AF532976.1-ACO1.m1Prunus persicamRNA
ACO1AF319166.1-ACO1.m1Prunus persicamRNA
ACO1AF129073.1-ACO1.m1Prunus persicamRNA
ACO1X77232.1-ACO1.m1Prunus persicamRNA
ACO1AB044712.1-ACO1.m1Prunus persicamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
1-aminocyclopropane-1-carboxylate oxidaseACOPrunus persicagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database AF532976.1-ACO1 scaffold_3:16205608..16206881
AF532976.1
gene parsed from NCBI nr database AF129073.1-ACO1 scaffold_3:16205608..16206881
AF129073.1
mRNA parsed from NCBI nr database JX876855.1-ACO1.m1 scaffold_3:16205608..16206029
JX876855.1
mRNA parsed from NCBI nr database JX876854.1-ACO1.m1 scaffold_3:16205608..16206082
JX876854.1
mRNA parsed from NCBI nr database JX876853.1-ACO1.m1 scaffold_3:16205608..16205836
JX876853.1
mRNA parsed from NCBI nr database JX876852.1-ACO1.m1 scaffold_3:16205608..16205891
JX876852.1
mRNA parsed from NCBI nr database JX876851.1-ACO1.m1 scaffold_3:16205608..16206931
JX876851.1
mRNA parsed from NCBI nr database AF532976.1-ACO1.m1 scaffold_3:16205608..16206881
AF532976.1
mRNA parsed from NCBI nr database AF319166.1-ACO1.m1 scaffold_3:16205608..16206881
AF319166.1
mRNA parsed from NCBI nr database AF129073.1-ACO1.m1 scaffold_3:16205608..16206881
AF129073.1
mRNA parsed from NCBI nr database X77232.1-ACO1.m1 scaffold_3:16205608..16206881
X77232.1
mRNA parsed from NCBI nr database AB044712.1-ACO1.m1 scaffold_4:642910..643801
AB044712.1

Sequence(s):
>AF532976.1-ACO11273
atggagaacttcccaatcatcaacttggagggcctcaatggagagggaagaaaagcaacaatggaaaaaatcaaagatgc
ctgtgagaactggggcttctttgaggtaattatatactaagatacatatatgcttagcttcttcatttctttgctctgtt
catcttttatcttcatcaaaattcaccttatatatgatgagtttgggttcacaaatattgcagcttgtgagtcatgggat
accaactgagtttttggacacagtggagaggttgacaaaagaacactacaggcagtgcttggagcagaggttcaaggagc
tggtggccagcaagggcctcgaggctgtcaagacagaggtcaatgatatggactgggaaagcaccttctacttgcgccat
cttccaaaatctaacatatctgaagttccagatcttgaggatcagtacaggtaaaaccaatcacacactacttttaaatt
tctctgtacataattaatttgaacataatgctagctagctagctggtgcttgttctttagagagattaatttacatgaaa
tatgcaggaatgtgatgaaggaatttgcattgaagttggagaaattagcagagcagctcctagacttgctctgtgagaat
cttggacttgaacaagggtacctcaagaaggccttctatggaacaaatggaccaacttttggcaccaaggttagcaacta
ccctccttgtcccaaccctgagctgatcaagggtctccgggctcacaccgatgccggcggcctcatcctgctcttccagg
atgacaaggtcagtggtctgcagctcctcaaagatggccaatggattgatgtgccccccatgcgccactccattgttatc
aaccttggtgaccaacttgaggtaacccaatattccgaatgaatgttacttcatgcccaattaatattaaatttacttac
atataaattttccctataggtaatcactaatgggaagtacaagagtgtggagcacagagtgattgcccaaactgatggca
ccagaatgtcaatagcttccttttacaaccctggcagtgatgctgtcatctatcctgcaccaacactggtggagaaagaa
gcagaggagaagaatcaagtgtacccgaaattcgtgttcgaagactacatgaagctctatgctggcctcaagttccagcc
caaggagccaagatttgaagccatgaaagcagtggaaaccaatatcagtttgggtccaattgcaacagcttaa
back to top
>AF129073.1-ACO11272
atggagaacttcccaatcatcaacttggagggcctcaatggagagggaagaaaagcaacaatggaaaaaatcaaagatgc
ctgtgagaactggggcttctttgaggtaattatatactaagatacatatatgcttagcttcttcatttctttgctctgtt
catcttttatcttcatcaaaattcaccttatatatgatgagtttgggttcacaaatattgcagcttgtgagtcatgggat
accaactgagtttttggacacagtggagaggttgacaaaagaacactacaggcagtgcttggagcagaggttcaaggagc
tggtggccagcaagggcctcgaggctgtcaagacagaggtcaatgatatggactgggaaagcaccttctacttgcgccat
cttccaaaatctaacatatctgaagttccagatcttgaggatcagtacagggtaaaccaatcacacactacttttaaatt
tctctgtacataattaatttgaacataatgctagctaactacctggtgcttgttctctagagagattaatttacatgaaa
tatgcagaatgtgatgaaggaatttgcattgaagttggagaaattagcagagcagctcctagacttgctctgtgagaatc
ttggacttgaacaagggtacctcaagaaggccttctatggaacaaatggaccaacttttggcaccaaggttagcaactac
cctccttgtcccaaccctgagctgatcaagggtctccgggctcacaccgatgccggcggcctcatcctgctcttccagga
tgacaaggtcagtggtctgcagctcctcaaagatggccaatggattgatgtgccccccatgcgccactccattgttatca
accttggtgaccaacttgaggtaacccaatattccgaatgaatgttacttcatgcccaattaatattaaatttacttaca
tataaattttccctataggtaatcactaatgggaagtacaagagtgtggagcacagagtgattgcccaaactgatggcac
cagaatgtcaatagcttccttttacaaccctggcagtgatgctgtcatctatcctgcaccaacactggtggagaaagaag
cagaggagaagaatcaagtgtacccgaaattcgtgttcgaagactacatgaagctctatgctggcctcaagttccagccc
aaggagccaagatttgaagccatgaaagcagtggaaaccaatatcagtttgggtccaattgcaacagcttaa
back to top
>JX876855.1-ACO1.m1343
gccccccatgcgccactccattgttatcaaccttggtgaccaacttgaggtaatcactaatgggaagtacaagagtgtgg
agcacagagtgattgcccaaactgatggcaccagaatgtcaatagcttccttttacaaccctggcagtgatgctgtcatt
tatcctgcaccaacactggtggagaaagaagcagaggagaagaatcaagtgtacccgaaatttgtgtttgaagactacat
gaagctttatgctggcctcaagttccagcccaaggagccaagatttgaagccatgaaagcagtggaaaccaatatcagtt
tgggtccaattgcaacagcttaa
back to top
>JX876854.1-ACO1.m1394
agatgacaggtcagtgtctgcagtcctcaaagatggccaatggattgatgtgccccccatgcgccactccattgttatca
accttggtgaccaacttgaggtaatcactaatgggaagtacaagagtgtggagcacagagtgattgcccaaactgatggc
accagaatgtcaatagcttccttttacaaccctggcagtgatgctgtcatctatcctgcaccaacactggtggagaaaga
agcagaggagaagaatcaagtgtacccgaaattcgtgttcgaagactacatgaagctctatgctggcctcaagttccagc
ccaaggagccaagatttgaagccatgaaagcagtggaaaccaatatcagtttgggtccaattgcaacagcttaa
back to top
>JX876853.1-ACO1.m1228
atgtcaatagcttccttttacaaccctggcagtgatgctgtcatctatcctgcaccaacactggtggagaaagaagcaga
ggagaagaatcaagtgtacccgaaattcgtgttcgaagactacatgaagctctatgctggcctcaagttccagcccaagg
agccaagatttgaagccatgaaagcagtggaaaccaatatcagtttgggtccaattgcaacagcttaa
back to top
>JX876852.1-ACO1.m1283
tgggaagtacaagagtgtggagcacagagtgattgcccaaactgatggcaccagaatgtcaatagcttccttttacaacc
ctggcagtgatgctgtcatctatcctgcaccaacactggtggagaaagaagcagaggagaagaatcaagtgtacccgaaa
ttcgtgttcgaagactacatgaagctttatgctggcctcaagttccagcccaaggagccaagatttgaagccatgaaagc
agtggaaaccaatatcagtttgggtccaattgcaacagcttaa
back to top
>JX876851.1-ACO1.m11010
agagagagagagagagagagaaagaaacacacacaaagagagagagagagatggagaacttcccaatcatcaacttggag
ggcctcaatggagagggaagaaaagcaacaatggaaaaaatcaaagatgcctgtgagaactggggcttctttgagcttgt
gagtcatgggataccaactgagtttttggacacagtggagaggttgacaaaagaacactacaggcagtgcttggagcaga
ggttcaaggagctggtggccagcaagggcctcgaggctgtcaagacagaggtcaatgatatggactgggaaagcaccttc
tacttgcgccatcttccaaaatctaacatatctgaagttccagatcttgaggatcagtacaggaatgtgatgaaggaatt
tgcattgaagttggagaaattagcagagcagctcctagacttgctctgtgagaatcttggacttgaacaagggtacctca
agaaggccttctatggaacaaatggaccaacttttggcaccaaggttagcaactaccctccttgtcccaaccctgagctg
atcaagggtctccgggctcacaccgatgccggcggcctcatcctgctcttccaggatgacaaggtcagtggtctgcagct
cctcaaagatggccaatggattgatgtgccccccatgcgccactccattgttatcaaccttggtgaccaacttgaggtaa
tcactaatgggaagtacaagagtgtggagcacagagtgattgcccaaactgatggcaccagaatgtcaatagcttccttt
tacaaccctggcagtgatgctgtcatctatcctgcaccaacactggtggagaaagaagcagaggagaagaatcaagtgta
cccgaaattcgtgttcgaagactacatgaagctctatgctggcctcaagttccagcccaaggagccaagatttgaagcca
tgaaagcagtggaaaccaatatcagtttgggtccaattgcaacagcttaa
back to top
>AF532976.1-ACO1.m1960
atggagaacttcccaatcatcaacttggagggcctcaatggagagggaagaaaagcaacaatggaaaaaatcaaagatgc
ctgtgagaactggggcttctttgagcttgtgagtcatgggataccaactgagtttttggacacagtggagaggttgacaa
aagaacactacaggcagtgcttggagcagaggttcaaggagctggtggccagcaagggcctcgaggctgtcaagacagag
gtcaatgatatggactgggaaagcaccttctacttgcgccatcttccaaaatctaacatatctgaagttccagatcttga
ggatcagtacaggaatgtgatgaaggaatttgcattgaagttggagaaattagcagagcagctcctagacttgctctgtg
agaatcttggacttgaacaagggtacctcaagaaggccttctatggaacaaatggaccaacttttggcaccaaggttagc
aactaccctccttgtcccaaccctgagctgatcaagggtctccgggctcacaccgatgccggcggcctcatcctgctctt
ccaggatgacaaggtcagtggtctgcagctcctcaaagatggccaatggattgatgtgccccccatgcgccactccattg
ttatcaaccttggtgaccaacttgaggtaatcactaatgggaagtacaagagtgtggagcacagagtgattgcccaaact
gatggcaccagaatgtcaatagcttccttttacaaccctggcagtgatgctgtcatctatcctgcaccaacactggtgga
gaaagaagcagaggagaagaatcaagtgtacccgaaattcgtgttcgaagactacatgaagctctatgctggcctcaagt
tccagcccaaggagccaagatttgaagccatgaaagcagtggaaaccaatatcagtttgggtccaattgcaacagcttaa
back to top
>AF319166.1-ACO1.m1960
atggagaacttcccaatcatcaacttggagggcctcaatggagagggaagaaaagcaacaatggaaaaaatcaaagatgc
ctgtgagaactggggcttctttgagcttgtgagtcatgggataccaactgagtttttggacacagtggagaggttgacaa
aagaacactacaggcagtgcttggagcagaggttcaaggagctggtggccagcaagggcctcgaggctgtcaagacagag
gtcaatgatatggactgggaaagcaccttctacttgcgccatcttccaaaatctaacatatctgaagttccagatcttga
ggatcagtacaggaatgtgatgaaggaatttgcattgaagttggagaaattagcagagcagctcctagacttgctctgtg
agaatcttggacttgaacaagggtacctcaagaaggccttctatggaacaaatggaccaacttttggcaccaaggttagc
aactaccctccttgtcccaaccctgagctgatcaagggtctccgggctcacaccgatgccggcggcctcatcctgctctt
ccaggatgacaaggtcagtggtctgcagctcctcaaagatggccaatggattgatgtgccccccatgcgccactccattg
ttatcaaccttggtgaccaacttgaggtaatcactaatgggaagtacaagagtgtggagcacagagtgattgcccaaact
gatggcaccagaatgtcaatagcttccttttacaaccctggcagtgatgctgtcatctatcctgcaccaacactggtgga
gaaagaagcagaggagaagaatcaagtgtacccgaaattcgtgttcgaagactacatgaagctctatgctggcctcaagt
tccagcccaaggagccaagatttgaagccatgaaagcagtggaaaccaatatcagtttgggtccaattgcaacagcttaa
back to top
>AF129073.1-ACO1.m1960
atggagaacttcccaatcatcaacttggagggcctcaatggagagggaagaaaagcaacaatggaaaaaatcaaagatgc
ctgtgagaactggggcttctttgagcttgtgagtcatgggataccaactgagtttttggacacagtggagaggttgacaa
aagaacactacaggcagtgcttggagcagaggttcaaggagctggtggccagcaagggcctcgaggctgtcaagacagag
gtcaatgatatggactgggaaagcaccttctacttgcgccatcttccaaaatctaacatatctgaagttccagatcttga
ggatcagtacaggaatgtgatgaaggaatttgcattgaagttggagaaattagcagagcagctcctagacttgctctgtg
agaatcttggacttgaacaagggtacctcaagaaggccttctatggaacaaatggaccaacttttggcaccaaggttagc
aactaccctccttgtcccaaccctgagctgatcaagggtctccgggctcacaccgatgccggcggcctcatcctgctctt
ccaggatgacaaggtcagtggtctgcagctcctcaaagatggccaatggattgatgtgccccccatgcgccactccattg
ttatcaaccttggtgaccaacttgaggtaatcactaatgggaagtacaagagtgtggagcacagagtgattgcccaaact
gatggcaccagaatgtcaatagcttccttttacaaccctggcagtgatgctgtcatctatcctgcaccaacactggtgga
gaaagaagcagaggagaagaatcaagtgtacccgaaattcgtgttcgaagactacatgaagctctatgctggcctcaagt
tccagcccaaggagccaagatttgaagccatgaaagcagtggaaaccaatatcagtttgggtccaattgcaacagcttaa
back to top
>X77232.1-ACO1.m1960
atggagaacttcccaatcatcaacttggagggcctcaatggagagggaagaaaagcaacaatggaaaaaatcaaagatgc
ctgtgagaactggggcttctttgagcttgtgagtcatgggataccaactgagtttttggacacagtggagaggttgacaa
aagaacactacaggcagtgcttggagcagaggttcaaggagctggtggccagcaagggcctcgaggctgtcaagacagag
gtcaatgatatggactgggaaagcaccttctacttgcgccatcttccaaaatctaacatatctgaagttccagatcttga
ggatcagtacaggaatgtgatgaaggaatttgcattgaagttggagaaattagcagagcagctcctagacttgctctgtg
agaatcttggacttgaacaagggtacctcaagaaggccttctatggaacaaatggaccaacttttggcaccaaggttagc
aactaccctccttgtcccaaccctgagctgatcaagggtctccgggctcacaccgatgccggcggcctcatcctgctctt
ccaggatgacaaggtcagtggtctgcagctcctcaaagatggccaatggattgatgtgccccccatgcgccactccattg
ttatcaaccttggtgaccaacttgaggtaatcactaatgggaagtacaagagtgtggagcacagagtgattgcccaaact
gatggcaccagaatgtcaatagcttccttttacaaccctggcagtgatgctgtcatctatcctgcaccaacactggtgga
gaaagaagcagaggagaagaatcaagtgtacccgaaattcgtgttcgaagactacatgaagctctatgctggcctcaagt
tccagcccaaggagccaagatttgaagccatgaaagcagtggaaaccaatatcagtttgggtccaattgcaacagcttaa
back to top
>AB044712.1-ACO1.m1810
tgtgaaaactggggcttctttgagttggtgaaccatgggatatctcatgagctgatggatactgtggagaagctgacaaa
ggagcactacaaaaagtgcatggagcaaaggtttaaggaaatggtcgcaagcaaaggccttgaagctgtccagtctgaaa
tccatgacttggactgggaaagcaccttcttcttgcgccaccttcctgtctctaacatatcccaaatccctgaccttgat
gaagattacaggaaggtcatgaaagaatttgcagtggaattagagaaactagctgagcaacttctggacttgctgtgtga
gaatcttgggttggagaagggttatctgaagaaggctttctatggatcaaagggaccaaacttcgggacaaaggtcagca
actatcctccttgccccaaaccagacctgatcaagggcctccgggcccacaccgatgcaggtggcatcatcctactcttc
caagatgacaaggtcagcggcctccagctcctcaaggatggtcaatggattgatgttcccccaatgcaccactccattgt
catcaacttaggtgatcaaattgaggtgatcactaatgggaaatacaagagtgtgatgcaccgtgtggtagcgcagccgg
atggtaccagaatgtccatagcctcattctacaacccaggtgatgatgcttttatctgcccagcaaccgcattgctggaa
aaagaaactgagaatatctcagcctaccccaaatttgtgtttgatgattacatgaagctctattctggcctcaagttcca
agcaaaagag
back to top