ACO1, ACO1 (gene) Pyrus communis

Gene Overview
Name ACO1
Gene Symbol ACO1
Type gene
Organism Pyrus communis
Synonym 1-aminocyclopropane-1-carboxylate oxidase
PCACO1
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
1-aminocyclopropane-1-carboxylate oxidaseACOPyrus communisgene_class


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
ACO1X87097.1-ACO1.m1Pyrus communismRNA
ACO1AJ504857.2-ACO1.m1Pyrus communismRNA


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
mRNA parsed from NCBI nr database X87097.1-ACO1.m1 N/A X87097.1
mRNA parsed from NCBI nr database AJ504857.2-ACO1.m1 N/A AJ504857.2

Sequence(s):
>X87097.1-ACO1.m1942
atggcgaccttcccagttgttgacttgagccttgtcaatggtgaagagagagtagcaaccttggagaagattaatgatgc
ttgtgagaactggggtttctttgagttggtgaaccatgggatgtctactgagcttttggacactgtggagaagatgacca
aggatcactacaagaagaccatggagcaaaggtttaaggaaatggtggcagccaaaggcctcgacgctgtccagtccgat
atccacgacttggactgggaaagcaccttcttcttgcgccaccttccttcaaacatttccgaagtccccgatctcgagga
agattacaggaagaccatgaaggaatttgcagtggaactggagaagctagctgagaagcttttggacttgctgtgtgaga
accttggactcgagaagggttatctgaagaaggttttctatggatccaagggtccgaattttgggaccaaggtcagcaac
taccctccatgccccaagccagacctgatcaagggactccgggcccacagcgacgccggtggcatcatcctgcttttcca
ggatgacaaggtcagcggcctccagcttctcaaggatggtgattgggtggatgtccccccaatgcaccactccattgtca
taaacttaggtgaccagattgaggtgatcaccaatgggaagtacaagagtgtgatgcaccgggtgatagctcagtcggac
cgggacaggatgtcgatagcctcgttctacaacccaggcgatgatgcctttatcagcccagcaccggcagtgcttgagaa
gaaaactgaggacgccccaacttatcccaagtttgtgtttgatgactacatgaagctgtattctggcctgaaattccaag
ccaaggagccaagatttgaagctatgaaggccaaggaatccacccttgttgcaactacctga
back to top
>AJ504857.2-ACO1.m1945
atggcgaccttcccagttgttgacttgagccttgtcaatggtgaagagagagtagcaaccttggagaagattaatgatgc
ttgtgagaactggggtttctttgagttggtgaaccatgggatatctactgagcttttggacactgtggagaagatgacca
aggatcactacaagaagaccatggagcaaaggtttaaggaaatggtggcagccaaaggcctcgacgctgtccagtccgaa
atccacgacttggactgggaaagcaccttcttcttgcgccaccttccttcctcaaacatttccgaagtccccgatctcga
ggaagattacaggaagaccatgaaagaatttgcagtggaactggagaagctagctgagaagcttttggacttgctgtgtg
agaatcttggactcgagaagggttatctgaagaaagttttcttaggatccaagggtccgaattttgggaccaaggtcagc
aactaccctccatgccacaagtcagatcggcccaagggactccgggcccacagcgacgccggtggcatcatcctgctttt
ccaggatgacaaggtcagcggcctccagcttctcaaggatggtgatggggtggatgtccccccaatgcaccactccattg
tcataaacttaggtgaccagattgaggtgatcaccaatgggaagtacaagagtgtgatgcaccgggtgatagctcagtcg
gacgggaccagaatgtcgatagcctcgttttacaacccaggcgatgatgcatttatcagcccagcaccggcagtgcttga
gaagaaaactgaggacgccccaacttatcccaagtttgtgtttgatgactacatgaagctgtattttggcctgaaattcc
aagccaaggagccaagatttgaagctatgaaggccaaggaatccccccttgttgcaactacctga
back to top