ACO1, ACO1 (gene) Pyrus pyrifolia

Gene Overview
Name ACO1
Gene Symbol ACO1
Type gene
Organism Pyrus pyrifolia
Synonym ACC oxidase
1-aminocyclopropane-1-carboxylate oxidase
Description NA
Comment PpACO1
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
ACO1JN807390.1-ACO1.m1Pyrus pyrifoliamRNA
ACO1FJ498793.1-ACO1.m1Pyrus pyrifoliamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
1-aminocyclopropane-1-carboxylate oxidaseACOPyrus pyrifoliagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
mRNA parsed from NCBI nr database JN807390.1-ACO1.m1 N/A JN807390.1
mRNA parsed from NCBI nr database FJ498793.1-ACO1.m1 N/A FJ498793.1

Sequence(s):
>JN807390.1-ACO1.m1945
atggcgaccttcccagttgttgacttgagccttgtcaatggtgaagagagagtagcaaccttggagaagatcaatgatgc
ttgtgagaactggggtttctttgagttggtgaaccatgggatatctactgagcttttggacactgtggagaagatgacca
aggatcactacaagaagaccatggagcaaaggtttaaggaaatggtggcagccaaaggcctcgacgctgtccagtccgaa
atccacgacttggactgggaaagcaccttcttcttgcgccaccttccttcctcaaacatttccgaagtccctgatctcga
ggaagattacaggaagaccatgaaagaatttgcagtggaactggagaagctagctgagaagcttttggacttgctgtgtg
agaatcttggactcgagaagggttatctgaagaaggttttctatggatccaagggtccgaattttgggaccaaggtcagc
aactaccctccatgccccaagccagacctgatcaagggactccgggcccacagcgacgccggtggcatcatcctgctttt
ccaggatgacaaggtcagcggcctccagcttctcaaggatggtgaatgggtggatgtccccccaatgcaccactccattg
tcataaacttaggtgaccagattgaggtgatcaccaatgggaagtacaagagtgtgatgcaccgggtgatagctcagtcg
gacgggaccagaatgtcgatagcctcgttctacaacccaggcgatgatgcctttatcagcccagcaccggcagtgcttga
gaagaaaactgaggacgccccaacttatcccaagtttgtgtttgatgactacatgaagctgtattctggcctgaaattcc
aagccaaggaaccaagatttgaagctatgaaggccaaggaatcgacccctgttgcaactacctga
back to top
>FJ498793.1-ACO1.m1341
gccaccttccttcctcaaacatttccgaagtccctgatctcgaggaagattacaggaagaccatgaaagaatttgcagtg
gaactggagaagctagctgagaagcttttggacttgctgtgtgagaatcttggactcgagaagggttatctgaagaaggt
tttctatggatccaagggtccgaattttgggaccaaggtcagcaactaccctccatgccccaagccagacctgatcaagg
gactccgggcccacagcgacgccggtggcatcatcctgcttttccaggatgacaaggtcagcggcctccagcttctcaag
gatggtgaatgggtggatgtt
back to top