ACO2, ACO2 (gene) Fragaria x ananassa

Gene Overview
Name ACO2
Gene Symbol ACO2
Type gene
Organism Fragaria x ananassa
Synonym 1-aminocyclopropane-1-carboxylate oxidase
Description ethylene biosynthesis
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
1-aminocyclopropane-1-carboxylate oxidaseACOFragaria x ananassagene_class


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
ACO2AJ851829.1-ACO2.m1Fragaria x ananassamRNA


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
mRNA parsed from NCBI nr database AJ851829.1-ACO2.m1 LG3:893420..893977
AJ851829.1

Sequence(s):
>AJ851829.1-ACO2.m1478
ttgagctggtgagccatgggatatcccatgagttgatggacaaggtggagaagctcacaaaggagcactacagaaagtgc
atggagcaaaggttcaaggaaatggtggcaagcaaaggtctcgaagctgtcaactctgaaatcgaagatttggactggga
aagcaccttcttcttgcgccatctccccttctccaacatttcccaagtccccgatctcgacgaagattacagggaggcca
tgaaggaatttgcagtggaactagagaagctggctgagcaactactggacttgttgtgtgagaatctggggctggagaag
ggttacctgaagaaggctttctatggatccaagggaccaaattttggtaccaaggtgagcaactaccctccatgccccaa
accggacctggtcaagggactccgggcccacaccgatgccggaggcgtcatcctgctgttccaagatgacaaggtcag
back to top