ACO2, ACO2 (gene) Malus x domestica

Gene Overview
Name ACO2
Gene Symbol ACO2
Type gene
Organism Malus x domestica
Synonym 1-aminocyclopropane-1-carboxylate oxidase
ACO2
Description NA
Comment ACC oxidase
MdACO2
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
ACO2AF015787.1-ACO2Malus x domesticagene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
ACO2AF015787.1-ACO2.m1Malus x domesticamRNA
ACO2DQ439790.1-ACO2.m1Malus x domesticamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
1-aminocyclopropane-1-carboxylate oxidaseACOMalus x domesticagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
predicted genes from whole genome assembly AF015787.1-ACO2 Chr05:47071398..47073186
chr5:801587..803375
chr5:791084..792872
AF015787.1
predicted genes from whole genome assembly AF015787.1-ACO2.m1 Chr05:47071456..47073047
chr5:801645..803236
chr5:791223..792814
AF015787.1
predicted genes from whole genome assembly DQ439790.1-ACO2.m1 Chr09:8747214..8747422
chr9:7857422..7857630
chr9:7894187..7894395
DQ439790.1

Sequence(s):
>AF015787.1-ACO21784
agaaagcgagagaaaactagagagagaaggaaatacaaagaaagcaatccaaagagaaatggcaactttcccagttgttg
acatggaccttatcaatggtgaagagagagcagcaaccttggagaagatcaatgatgcatgtgagaactggggtttcttt
gaggtacgtaaccccaacaaagctttgcgatatttttttcttcctcaaggcacaaaactccgtccctcgtgtgcttagag
taaatccgtctctaagcatatgagagtcggaaaacaaatacaccgccctggttgctcagtttttttggtactgccttaat
ttctgtagaaatatgacaactctttgttttgtgtataaataactgaagttggtgaaccatgggatatcaactgagctttt
ggacactgtggagaagatgaacaaggatcactacaagaagaccatggagcaaaggttcaaggaaatggtggcagccaaag
gcctcgaagctgtccagtccgaaatccactacttggactgggaaagcaccttcttcttgcgccaccttccttcctcaaac
atttccgaaatccctgatctcgaggaagattacaggtcacactaattacaacaaacttaattaatttcccgctgatttgg
atttaaccaagttagctaaagcaccttgcggccccattgcacctaagtttggatctcggttttgtagactagattgtatt
agaatatcatattgagggcttgtatatattttgaacaatatttcaggaagaccatgaaggaatttgcagtggaattggag
aagctagctgagaagcttttggacttgctgtgtgagaatcttggacttgagaagggctatctgaagaaggctttctatgg
atccaagggtccgaattttgggaccaaggtcagcaactaccctccatgtcccaagccagacctgatcaagggactccggg
cccacaccgacgctggtggtatcatcctgcttttccaggatgacaaggtcagtggcctccagctcctcaaggatggtgaa
tggatggatgtccccccagtgcaccactccattgtcatcaacttaggtgaccagattgaggtataccaaattaccagtta
cccatgtcttattggccggacgtccgatgtatcatcaataatatattagtatcactgtcgtcaacaaaacgtacagacat
gttaccgatacatttcaacgctcaaccgttttataataaagaggacgtactcatacacagataatttttacttttaccat
caagtttactaaatgttagactataattattttaaacaggtgatcactaatgggaagtacaagagtataatgcaccgggt
gatagctcagtcggacggaaccagaatgtcgatagcgtcgttctacaacccgggcgacgatgcgtttatcagcccggcac
cggcattgctggaggagaaatctgaggtttccccaacttatcccaaatttttgtttgatgattacatgaagctgtactct
ggcctcaaattccaagccaaggagccaagatttgaagctatgaaggccagggaaaccacccctgttgaaactgcccgagg
tctgagagccgtccgatggaacacgacaaaaagaaatcaaaattagggttttgggttttatcctttgtgctaaataaagt
tggggaggagaaagtaagagttttacttttttctccactgttctatagttgaaatctatctatataaaataaaaattatt
agaatcctaatgtttgagggatcc
back to top
>AF015787.1-ACO2.m1993
atggcaactttcccagttgttgacatggaccttatcaatggtgaagagagagcagcaaccttggagaagatcaatgatgc
atgtgagaactggggtttctttgagttggtgaaccatgggatatcaactgagcttttggacactgtggagaagatgaaca
aggatcactacaagaagaccatggagcaaaggttcaaggaaatggtggcagccaaaggcctcgaagctgtccagtccgaa
atccactacttggactgggaaagcaccttcttcttgcgccaccttccttcctcaaacatttccgaaatccctgatctcga
ggaagattacaggaagaccatgaaggaatttgcagtggaattggagaagctagctgagaagcttttggacttgctgtgtg
agaatcttggacttgagaagggctatctgaagaaggctttctatggatccaagggtccgaattttgggaccaaggtcagc
aactaccctccatgtcccaagccagacctgatcaagggactccgggcccacaccgacgctggtggtatcatcctgctttt
ccaggatgacaaggtcagtggcctccagctcctcaaggatggtgaatggatggatgtccccccagtgcaccactccattg
tcatcaacttaggtgaccagattgaggtgatcactaatgggaagtacaagagtataatgcaccgggtgatagctcagtcg
gacggaaccagaatgtcgatagcgtcgttctacaacccgggcgacgatgcgtttatcagcccggcaccggcattgctgga
ggagaaatctgaggtttccccaacttatcccaaatttttgtttgatgattacatgaagctgtactctggcctcaaattcc
aagccaaggagccaagatttgaagctatgaaggccagggaaaccacccctgttgaaactgcccgaggtctgagagccgtc
cgatggaacacgacaaaaagaaatcaaaattag
back to top
>DQ439790.1-ACO2.m1208
cagtgatgcggtgatctacccagcaccaaccctagtggagaaagaagcagaggagaagaatcaagtgtacccgaaattcg
tgttcgaagactacatgaagctctatgctggggtcaagttcgaggccaaggaaccaagatttgaagccatgaaagcagtg
gaaattaaggccagttttggtttgggtccagttataagtactgcttga
back to top