ACO2, ACO2 (gene) Prunus persica

Gene Overview
Name ACO2
Gene Symbol ACO2
Type gene
Organism Prunus persica
Synonym 1-aminocyclopropane-1-carboxylate oxidase
PP-ACO2
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
ACO2AF129074.2-ACO2Prunus persicagene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
ACO2AF129074.2-ACO2.m1Prunus persicamRNA
ACO2AB044711.1-ACO2.m1Prunus persicamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
1-aminocyclopropane-1-carboxylate oxidaseACOPrunus persicagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database AF129074.2-ACO2 scaffold_4:642834..644080
AF129074.2
mRNA parsed from NCBI nr database AF129074.2-ACO2.m1 scaffold_4:642834..644080
AF129074.2
mRNA parsed from NCBI nr database AB044711.1-ACO2.m1 scaffold_3:16205684..16206660
AB044711.1

Sequence(s):
>AF129074.2-ACO21246
atggagactttcccagttgttgacttgagccaaattactggtgaaaagagagaagctgccatggagaagatgaatgatgc
ttgtgagaattggggtttctttgaggtaaaccaacctttagctgctttagatctttttatttcttttaaagctttgatga
gaagtcagctagttaattacaaatgatgtttttttgatgtttttttctttctatatcacgatcatatgtgtttctaataa
taactctttttttttaatatatacaaattaattaatgaagttggtgaaccatgggatatctcatgagctgatggatactg
tggagaagctgacaaaggagcactacaaaaagtgcatggagcaaaggtttaaggaaatggtcgcaagcaaaggccttgaa
gctgtccagtctgaaatccatgacttggactgggaaagcaccttcttcttgcgccaccttcctgtctctaacatatccca
aatccctgaccttgatgaagattacaggaaggtcatgaaagaatttgcagtggaattagagaaactagctgagcaacttc
tggacttgctgtgtgagaatcttgggttggagaagggttatctgaagaaggctttctatggatcaaagggaccaaacttc
gggacaaaggtcagcaactatcctccttgccccaaaccagacctgatcaagggcctccgggcccacaccgatgcaggtgg
catcatcctactcttccaagatgacaaggtcagcggcctccagctcctcaaggatggtcaatggattgatgttcccccaa
tgcaccactccattgtgatcaacttaggtgatcaacttgaggtacaaataccataacccagtttcaaatgttgactgttt
ttttcttcccattaaaatggttattttaaatctcaaatttactaattaaaatgtgatttgaaattattaatataggtgat
cactaatgggaaatacaagagtgtgatgcaccgtgtgatagcgcagccggatggtaccagaatgtccatagcctcattct
acaacccaggtgatgatgcttttatctgcccagcaccagcattgctggaaaaagaaactgagaatatctcagcctacccc
aaatttgtgtttgatgattacatgaagctctattctggcctcaaattccatgccaaggaaccaagatttgaagccatgaa
ggccatggaatccaccgttaatttggaccctgttgcaactgtctga
back to top
>AF129074.2-ACO2.m1957
atggagactttcccagttgttgacttgagccaaattactggtgaaaagagagaagctgccatggagaagatgaatgatgc
ttgtgagaattggggtttctttgagttggtgaaccatgggatatctcatgagctgatggatactgtggagaagctgacaa
aggagcactacaaaaagtgcatggagcaaaggtttaaggaaatggtcgcaagcaaaggccttgaagctgtccagtctgaa
atccatgacttggactgggaaagcaccttcttcttgcgccaccttcctgtctctaacatatcccaaatccctgaccttga
tgaagattacaggaaggtcatgaaagaatttgcagtggaattagagaaactagctgagcaacttctggacttgctgtgtg
agaatcttgggttggagaagggttatctgaagaaggctttctatggatcaaagggaccaaacttcgggacaaaggtcagc
aactatcctccttgccccaaaccagacctgatcaagggcctccgggcccacaccgatgcaggtggcatcatcctactctt
ccaagatgacaaggtcagcggcctccagctcctcaaggatggtcaatggattgatgttcccccaatgcaccactccattg
tgatcaacttaggtgatcaacttgaggtgatcactaatgggaaatacaagagtgtgatgcaccgtgtgatagcgcagccg
gatggtaccagaatgtccatagcctcattctacaacccaggtgatgatgcttttatctgcccagcaccagcattgctgga
aaaagaaactgagaatatctcagcctaccccaaatttgtgtttgatgattacatgaagctctattctggcctcaaattcc
atgccaaggaaccaagatttgaagccatgaaggccatggaatccaccgttaatttggaccctgttgcaactgtctga
back to top
>AB044711.1-ACO2.m1804
gagcttgtgagtcatgggataccaactgagtttttggacacagtggagaggttgacaaaagaacactacaggcagtgctt
ggagcagaggttcaaggagctggtggccagcaagggcctcgaggctgtcaagacagaggtcaatgatatggactgggaaa
gcaccttctacttgcgccatcttccaaaatctaacatatctgaagctccagatcttgaggatcagtacaggaatgtgatg
aaggaatttgcattgaagttggagaaattagcagagcagctcctagacttgctctgtgagaatcttggacttgaacaagg
gtacctcaagaaggccttctatggaacaaatggaccaacttttggcaccaaggttagcaactaccctccttgtcccaacc
ctgagctgatcaagggtctccgggctcacaccgatgccggcggcctcatcctgctcttccaggatgacaaggtcagtggt
ctgcagctcctcaaagatggccaatgggttgatgtgccccccatgcgccactccattgttatcaaccttggtgaccaact
tgaggtaatcactaatgggaagtacaagagtgtggagcacagagtgattgcccaaactgatggcaccagaatgtcaatag
cttccttttacaaccctggcagtgatgctgtcatctatcctgcaccaacactggtggagaaagaagcagaggagaagaat
caagtgtacccgaaattcgtgttcgaagactacatgaagctctatgctggcctcaagttccaagcaaaagaaccgctgca
gttt
back to top