ACO4, ACO4 (gene) Pyrus pyrifolia

Gene Overview
Name ACO4
Gene Symbol ACO4
Type gene
Organism Pyrus pyrifolia
Synonym 1-aminocyclopropane-1-carboxylate oxidase
PPAOX4
P-ACO4
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
1-aminocyclopropane-1-carboxylate oxidaseACOPyrus pyrifoliagene_class


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
ACO4AF195222.1-ACO4.m1Pyrus pyrifoliamRNA
ACO4AB042111.1-ACO4.m1Pyrus pyrifoliamRNA


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
mRNA parsed from NCBI nr database AF195222.1-ACO4.m1 N/A AF195222.1
mRNA parsed from NCBI nr database AB042111.1-ACO4.m1 scaffold00208:41368..42906
AB042111.1

Sequence(s):
>AF195222.1-ACO4.m1150
atggttgctttccccttccacatacgcaagccaacaagagctcatgatatgtccgacctttccaacctactgctacacgg
aaccctgcctcttttttattctgactattactccaactctgatgcctcttctgaatctagatataggtag
back to top
>AB042111.1-ACO4.m1945
atggcgactttcccagttgttgacatgagccttgtcaatggtgaagagagagcagcaaccttggagaagatcaatgatgc
atgtgagaactggggtttctttgagttggtgaaccatgggatatcaactgagcttttggacactgtggagaagatgaaca
aggatcactacaagaagaccatggagcaaaggttcaaggaaatggtggtagccaagggcctcgacgctgtccagtcccaa
atccacgacttggactgggaaagcaccttcttcttgcgccaccttccttcctcaaacatttccgaaatccctgatctcga
ggaagattacaggaagaccatgaaggaatttgcagtggaattggagaagctagctgagacgcttttggacttgctgtgtg
agaatcttggacttgagaagggctatctaaagaaggctttctatggatccaagggtccgaattttgggaccaaggtcagc
aactaccctccatgtcccaagccagacctgatcaagggactccgggcccacaccgacgctggtggtatcatcctgctctt
ccaggatgacaaggtcagcggcctccagctcctcaaggatggtgaatgggtggatgttcccccaatgcaccactccattg
tcatcaacttaggtgaccagattgaggtgatcaccaatgggaagtacaagagtataatgcaccgggtgatagctcagtcg
gacggaaccagaatgtcgatagcctcgttctacaacccgggcgacgatgcgtttatcagcccggcaccggcattgctgga
gaagaaatctgaggaaaccccaacttatcccaaatttttgtttgatgattacatgaagctgtattctggcctcaaattcc
aagccaaggagccaagatttgaagctatgaaggccagggaaacctcctcggttgcaactgcctga
back to top