ACO, ACO (gene) Eriobotrya japonica

Gene Overview
Name ACO
Gene Symbol ACO
Type gene
Organism Eriobotrya japonica
Synonym 1-aminocyclopropane-1-carboxylate oxidase
Description NA
Comment EjACO-1
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
1-aminocyclopropane-1-carboxylate oxidaseACOEriobotrya japonicagene_class


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
ACOGU233743.1-ACO.m1Eriobotrya japonicamRNA
ACOGQ377219.3-ACO.m1Eriobotrya japonicamRNA


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
mRNA parsed from NCBI nr database GU233743.1-ACO.m1 N/A GU233743.1
mRNA parsed from NCBI nr database GQ377219.3-ACO.m1 N/A GQ377219.3

Sequence(s):
>GU233743.1-ACO.m1969
atggagaacttcccagttatcaacttgcagagcctcaatggtgagggaagaaaagctacaatggaaaagatcaaagatgc
ctgtgagaactggggtttctttgagttggtgagtcatgggattccaactgagtttctggacacagtggagaggctgacaa
aagagcactacaagcagtgtttggagcaaaggttcaaggagctggtggccagcaaaggccttgagggtgttcggacagag
gtcaaagatatggattgggaaagcactttccacttgcgccatcttcctcaatcgaacatctctgaagtaccagatctcaa
ggatgagtacaggaatgtgatgaaggagtttgcattgaaattggagaaattagcagagcagctgctggacttgttgtgtg
agaatcttggactggaacaagggtaccttaagaaggcattttatggaacaaatggaccaacttttggcaccaaggtgagc
aactaccctccatgtcccaacccagacctgatcaagggtctccgggcccacaccgatgccggcggcctcatcttgctctt
ccaggatgacaaggtcagtggcctccagctcctcaaggacggagagtgggttgatgtgcctcccatgcgccactccattg
ttatcaatcttggtgaccaacttgaggtgatcaccaacggaaagtacaagagtgcggaacacagggtgattgcccaaaca
gatggcaccagaatgtcaatagcttcattctacaacccaggcagtgatgcggtgatctacccagcaccaaccctagtgga
gaaagaagcagaggagaagaatcaagtgtacccgaaattcgtgttcgaagactacatgaagctctatgctggggtcaagt
tcgaggccaaggaaccaagatttgaagccatgaaagcagtggaaattaaggccagttttggtttgggtccagttataagt
cctgcttga
back to top
>GQ377219.3-ACO.m1969
atggagaacttcccagttatcaacttgcagagcctcaatggtgagggaagaaaagctacaatggaaaagatcaaagatgc
ctgtgagaactggggtttctttgagttggtgagtcatgggattccaactgagtttctggacacagtggagaggctgacaa
aagagcactacaagcagtgtttggagcaaaggttcaaggagctggtggccagcaaaggccttgagggtgttcggacagag
gtcaaagatatggattgggaaagcactttccacttgcgccatcttcctcaatcgaacatctctgaagtaccagatctcaa
ggatgagtacaggaatgtgatgaaggagtttgcattgaaattggagaaattagcagagcagctgctggacttgttgtgtg
agaatcttggactggaacaagggtaccttaagaaggcattttatggaacaaatggaccaacttttggcaccaaggtgagc
aactaccctccatgtcccaacccagacctgatcaagggtctccgggcccacaccgatgccggcggcctcatcttgctctt
ccaggatgacaaggtcagtggcctccagctcctcaaggacggagagtgggttgatgtgcctcccatgcgccactccattg
ttatcaatcttggtgaccaacttgaggtgatcaccaacggaaagtacaagagtgcggaacacagggtgattgcccaaaca
gatggcaccagaatgtcaatagcttcattctacaacccaggcagtgatgcggtgatctacccagcaccaaccctagtgga
gaaagaagcagaggagaagaatcaagtgtacccgaaattcgtgttcgaagactacatgaagctctatgctggggtcaagt
tcgaggccaaggaaccaagatttgaagccatgaaagcagtggaaattaaggccagttttggtttgggtccagttataagt
cctgcttga
back to top