ACO, ACO (gene) Fragaria x ananassa

Gene Overview
Name ACO
Gene Symbol ACO
Type gene
Organism Fragaria x ananassa
Synonym 1-aminocyclopropane-1-carboxylate oxidase
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
ACOAY706156.1-ACO.m1Fragaria x ananassamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
1-aminocyclopropane-1-carboxylate oxidaseACOFragaria x ananassagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
mRNA parsed from NCBI nr database AY706156.1-ACO.m1 N/A AY706156.1

Sequence(s):
>AY706156.1-ACO.m1963
atggagaactttccagtcatcaacatggagaaactcaacggtgaagagagaaacgcaacaatggaaaccatcaaagatgc
ctgtgagaactggggtttctttgagctggtgaatcatgggatacccactgtgtttctggacacggtggagaagatgacca
aagaccactacaagaattgtttggagcaaaggtttaaggagccggtggccagcaaaggccttaacgcagttaacactgag
gtcaatgacatggactgggagagcaccttctacctcaaacaccttccccgctccaacatctcagaagtcccagatctcga
cgaagagtacaggaaggtcatgaaggatttcgctctgaaactggagaagctagcagaggagctcttggacttgttctgtg
agaatcttggactggaagaagggtacctcaagaaggccttctatggctcccagggtagtcctacctttggcactaaggtc
agcaactaccctccgtgccccaccccggacctcatcaagggtctccggtctcacaccgacgccggcggcgacatccttct
gttccaggatgacaaggtcagtggccttcagctcctcaaggatggggaatggattgatgtgcccccaatgcgccactcca
ttgttatcaaccttggtgaccagcttgaggtgattactaatgggaagtacaagagtgtggagcacagagtgattgcccag
acagatggcaccagaatgtcaatagcttcattctacaaccctggaagtgatgcagttatctacccggcaccatctttggt
ggagacagaaacagaggagaagaatcaagtatacccgaaattcgtgttcgatgactacatgaagctctatgcagtcctca
agttccaggccaaggaacccagatttgaagccatgaaaacagttgaagccaatcccagtttggctgcaattgctacagct
taa
back to top