ACO, ACO (gene) Malus x domestica

Gene Overview
Name ACO
Gene Symbol ACO
Type gene
Organism Malus x domestica
Synonym ACC oxidase
1-aminocyclopropene-1-carboxylate oxidase
Description Converts ACC into ethylene in apple fruit
involved in the apple fruit ripening
Comment 1-aminocyclopropane-1-carboxylate oxidase
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
ACODQ438990.1-ACOMalus x domesticagene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
ACOAF030859.1-ACO.m1Malus x domesticamRNA
ACODQ438990.1-ACO.m1Malus x domesticamRNA
ACOY14005.1-ACO.m1Malus x domesticamRNA
ACOX98627.1-ACO.m1Malus x domesticamRNA
ACOAJ001646.1-ACO.m1Malus x domesticamRNA
ACOAB086888.1-ACO.m1Malus x domesticamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
1-aminocyclopropane-1-carboxylate oxidaseACOMalus x domesticagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
predicted genes from whole genome assembly DQ438990.1-ACO Chr05:47072211..47072954
chr5:802400..803143
chr5:791316..792059
DQ438990.1
predicted genes from whole genome assembly AF030859.1-ACO.m1 Chr10:40754956..40756594
chr10:32199149..32200787
chr10:36882772..36884410
AF030859.1
predicted genes from whole genome assembly DQ438990.1-ACO.m1 Chr05:47072211..47072954
chr5:802400..803143
chr5:791316..792059
DQ438990.1
predicted genes from whole genome assembly Y14005.1-ACO.m1 Chr10:40754956..40756594
chr10:32199149..32200787
chr10:36882772..36884410
Y14005.1
predicted genes from whole genome assembly X98627.1-ACO.m1 Chr10:40754956..40756594
chr10:32199149..32200787
chr10:36882772..36884410
X98627.1
predicted genes from whole genome assembly AJ001646.1-ACO.m1 Chr10:40754956..40756594
chr10:32199149..32200787
chr10:36882772..36884410
AJ001646.1
predicted genes from whole genome assembly AB086888.1-ACO.m1 Chr09:8745930..8747422
chr9:7856138..7857630
chr9:7892903..7894395
AB086888.1

Sequence(s):
>DQ438990.1-ACO743
gaagcttttggacttgctgtgtgagaatcttggacttgagaagggctatctgaagaaggctttctatggatccaagggtc
cgaattttgggaccaaggtcagcaactaccctccatgtcccaagccagacctgatcaagggactccgggcccacaccgac
gctggtggtatcatcctgcttttccaggatgacaaggtcagcggcctccagctcctcaaggatggtgaatggatggatgt
ccccccagtgcaccactccattgtcatcaacttaggtgaccagattgaggtataccaaattaccagttacccatgtctta
ttggccggacgtccgatgtatcatcaataatatattagtatcactgtcgtcaacaaaacgtacagacatgttaccgatac
atttcaacgctcaaccgttttataataaagaggacgtacgtcatacacagataatttttacttttaccatcaagtttact
aaatgttagactataattatttgatgcaggtgatcaccaatgggaagtacaagagtataatgcaccgggtgatagctcag
tcggacggaaccagaatgtcgatagcctcgttctacaacccgggcgacgatgcgtttatcagcccggcaccggcattgct
ggagaagaaatctgaggaaaccccaacttatcccaaatttttgtttgatgattacatgaagctgtattctggcctcaaat
tccaagccaaggagccaagattt
back to top
>AF030859.1-ACO.m1945
atggcgactttcccagttgttgacttgagccttgtcaatggtgaagagagagcagcaaccttggagaagatcaatgatgc
ttgtgagaactggggtttctttgagctggtgaaccatgggatgtctactgagcttttggacactgtggagaagatgacca
aggatcactacaagaagaccatggagcaaaggtttaaggaaatggtggcagccaaaggcctcgacgatgtccagtccgaa
atccacgacttggactgggaaagcaccttcttcttgcgccaccttccttcctcaaacatttccgaaatccctgatctcga
ggaagagtacaggaagaccatgaaggaatttgcagtggaactggagaagctagctgagaagcttttggacttgctgtgtg
agaatcttggactcgagaagggttatctgaagaaggttttctatggatccaagggtccgaattttgggaccaaggtcagc
aactaccctccatgccccaagccagacctgatcaagggactccgggcccacagcgacgccggtggcatcatcctgctttt
ccaggatgacaaggtcagcggcctccagcttctcaaggatggtgaatgggtggatgtccccccaatgcaccactccattg
tcataaacttaggtgaccagattgaggtgatcaccaatgggaagtacaaaagtgtgatgcaccgggtgatagctcagtcg
gatgggaccagaatgtcgatagcctcgttctacaacccaggcaacgactcattcatcagcccagcaccggcagtgcttga
gaagaaaactgaggacgccccaacttatcccaagtttgtgtttgatgactacatgaagctgtattctggcctgaaattcc
aagccaaggagccaagatttgaagctatgaaggccaaggaatccacccctgttgcaactgcctga
back to top
>DQ438990.1-ACO.m1523
gaagcttttggacttgctgtgtgagaatcttggacttgagaagggctatctgaagaaggctttctatggatccaagggtc
cgaattttgggaccaaggtcagcaactaccctccatgtcccaagccagacctgatcaagggactccgggcccacaccgac
gctggtggtatcatcctgcttttccaggatgacaaggtcagcggcctccagctcctcaaggatggtgaatggatggatgt
ccccccagtgcaccactccattgtcatcaacttaggtgaccagattgaggtgatcaccaatgggaagtacaagagtataa
tgcaccgggtgatagctcagtcggacggaaccagaatgtcgatagcctcgttctacaacccgggcgacgatgcgtttatc
agcccggcaccggcattgctggagaagaaatctgaggaaaccccaacttatcccaaatttttgtttgatgattacatgaa
gctgtattctggcctcaaattccaagccaaggagccaagattt
back to top
>Y14005.1-ACO.m1945
atggcgactttcccagttgttgacttgagccttgtcaatggtgaagagagagcagcaaccttggagaagatcaatgatgc
ttgtgagaactggggtttctttgagctggtgaaccatgggatgtctactgagcttttggacactgtggagaagatgacca
aggatcactacaagaagaccatggagcaaaggtttaaggaaatggtggcagccaaaggcctcgacgatgtccagtccgaa
atccacgacttggactgggaaagcaccttcttcttgcgccaccttccttcctcaaacatttccgaaatccctgatctcga
ggaagagtacaggaagaccatgaaggaatttgcagtggaactggagaagctagctgagaagcttttggacttgctgtgtg
agaatcttggactcgagaagggttatctgaagaaggttttctatggatccaagggtccgaattttgggaccaaggtcagc
aactaccctccatgccccaagccagacctgatcaagggactccgggcccacagcgacgccggtggcatcatcctgctttt
ccaggatgacaaggtcagcggcctccagcttctcaaggatggtgaatgggtggatgtccccccaatgcaccactccattg
tcataaacttaggtgaccagattgaggtgatcaccaatgggaagtacaaaagtgtgatgcaccgggtgatagctcagtcg
gatgggaccagaatgtcgatagcctcgttctacaacccaggcaacgactcattcatcagcccagcaccggcagtgcttga
gaagaaaactgaggacgccccaacttatcccaagtttgtgtttgatgactacatgaagctgtattctggcctgaaattcc
aagccaaggagccaagatttgaagctatgaaggccaaggaatccacccctgttgcaactgcctga
back to top
>X98627.1-ACO.m1945
atggcgactttcccagttgtcgacttgagccttgtcaatggtgaagagagagcagcaaccttggagaagatcaatgatgc
ttgtgagaactggggtttctttgagctggtgaaccatgggatgtctactgagcttttggacactgtggagaagatgacca
aggatcactacaagaagaccatggagcaaaggtttaaggaaatggtggcagccaaaggcctcgacgatgtccagtccgaa
atccacgacttggactgggaaagcaccttcttcttgcgccaccttccttcctcaaacatttccgaaatccctgatctcga
ggaagattacaggaagaccatgaaggaatttgcagtggaactggagaagctagctgagaagcttttggacttgctgtgtg
agaatcttggactcgagaagggttatctgaagaaggttttctatggatccaagggtccgaattttgggaccaaggtcagc
aactaccctccatgccccaagccagacctgatcaagggactccgggcccacagcgacgccggtggcatcatcctgctttt
ccaggatgacaaggtcagcggcctccagcttctcaaggatggtgaatgggtggatgtccccccaatgcaccactccattg
tcataaacttaggtgaccagattgaggtgatcaccaatgggaagtacaaaagtgtgatgcaccgggtgatagctcagtcg
gatgggaccagaatgtcgatagcctcgttctacaacccaggcaacgacgcattcatcagcccagcaccggcagtgcttga
gaagaaaactggggacgccccaacttatcccaagtttgtgtttgatgactacatgaagctgtattctggcctgaaattcc
aagccaaggagccaagatttgaagctatgaaggccaaggaacccacccctgttgcaactgcctga
back to top
>AJ001646.1-ACO.m1945
atggcgactttcccagttgtcgacttgagccttgtcaatggtgaagagagagcagcaaccttggagaagatcaatgatgc
ttgtgagaactggggtttctttgagctggtgaaccatgggatgtctactgagcttttggacactgtggagaagatgacca
aggatcactacaagaagaccatggagcaaaggtttaaggaaatggtggcagccaaaggcctcgacgatgtccagtccgaa
atccacgacttggactgggaaagcaccttcttcttgcgccaccttccttcctcaaacatttccgaaatccctgatctcga
ggaagattacaggaagaccatgaaggaatttgcagtggaactggagaagctagctgagaagcttttggacttgctgtgtg
agaatcttggactcgagaagggttatctgaagaaggttttctatggatccaagggtccgaattttgggaccaaggtcagc
aactaccctccatgccccaagccagacctgatcaagggactccgggcccacagcgacgccggtggcatcatcctgctttt
ccaggatgacaaggtcagcggcctccagcttctcaaggatggtgaatgggtggatgtccccccaatgcaccactccattg
tcataaacttaggtgaccagattgaggtgatcaccaatgggaagtacaaaagtgtgatgcaccgggtgatagctcagtcg
gatgggaccagaatgtcgatagcctcgttctacaacccaggcaacgacgcattcatcagcccagcaccggcagtgcttga
gaagaaaactggggacgccccaacttatcccaagtttgtgtttgatgactacatgaagctgtattctggcctgaaattcc
aagccaaggagccaagatttgaagctatgaaggccaaggaacccacccctgttgcaactgcctga
back to top
>AB086888.1-ACO.m1969
atggagaacttcccagttatcaacttggagagcctcaatggtgagggaagaaaagctacaatggaaaagatcaaagatgc
ctgtgagaactggggtttttttgagctggtgagtcatgggattccaactgagtttctggacacagtggagaggctgacaa
aagagcactacaagcagtgtttggagcaaaggttcaaggagctggtggccagcaaaggccttgagggtgttcagacagaa
gtcaaagatatggattgggaaagcactttccacttgcgccatcttcctcaatcgaacatctctgaagtaccagatctcaa
ggatgagtacaggaatgtgatgaaggagtttgcattgaaattggaaaaattagcagagcagctgctggacttgttgtgtg
agaatcttggactggaacaagggtaccttaagaaggcattttatggaacaaagggaccaacttttggcaccaaggtgagc
aactaccctccatgtcccaacccagacctgatcaagggtctccgggcccacaccgatgccggcggcctcatcttgctctt
ccaggatgacaaggtcagtggcctccagctcctcaaggacggagagtgggttgatgtgcctcccatgcgccactccattg
ttatcaatcttggtgaccaacttgaggtgatcaccaacggaaagtacaagagtgtggaacacagggtgattgcccaaaca
gatggcaccagaatgtcaatagcttcattctacaacccaggcagtgatgcggtgatctacccagcaccaaccctagtgga
gaaagaagcagaggagaagaatcaagtgtacccgaaatccgtgttcgaagactacatgaagctctatgctggggtcaagt
tcgaggccaaggaaccaagatttgaagccatgaaagcagtggaaattaaggccagttttggtttgggnccagttataagt
actgcttga
back to top