ACO, ACO (gene) Prunus mume

Gene Overview
Name ACO
Gene Symbol ACO
Type gene
Organism Prunus mume
Synonym 1-aminocyclopropane-1-carboxylate oxidase
ACC oxidase
PM-ACO1
PmACO
Description NA
Comment 1-aminocyclopropane-1-carboxylic acid oxidase
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
1-aminocyclopropane-1-carboxylate oxidaseACOPrunus mumegene_class


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
ACOAB499127.1-ACO.m1Prunus mumemRNA
ACOAB031027.1-ACO.m1Prunus mumemRNA


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
mRNA parsed from NCBI nr database AB499127.1-ACO.m1 scaffold_3:16205672..16206881
AB499127.1
mRNA parsed from NCBI nr database AB031027.1-ACO.m1 scaffold_3:16205608..16206881
AB031027.1

Sequence(s):
>AB499127.1-ACO.m1915
atggagaacttcccaatcatcaacttggagggcctcaatggagagggaaggaaagcaacaatggaaaaaatcaaagatgc
ctgtgagaactggggcttctttgagcttgtgagtcatgggataccaactgagtttttggacacagtggagaggttgacta
aagaacactacaggcagtgcttggagcagaggttcaaggagctggtggccagcaagggccttgaggctgtcaagacagag
gtcaatgatatggactgggaaagcaccttctacttgcgccatcttccaaaatctaacatatctgaagttccagatcttga
ggatcagtacaggaatgtgatgaaggaatttgcattgaagttggagaaattagcagagcagctcctagacttgctctgtg
agaatcttggacttgaacaagggtacctcaagaaggccttctatggaacaaatggaccaacttttggcaccaaggttagc
aactaccctccttgtcccaaccctgagctgatcaagggtctccgggctcacaccgatgccggcggcctcatcctgctctt
ccaggatgacaaggtcagtggtctgcagctcctcaaggatggccaatggattgatgtgcctcccatgcgccactccattg
ttatcaaccttggtgaccaacttgaggtgatcactaacgggaagtacaagagcgtggagcacagagtgattgcccaaact
gatggcaccagaatgtcaatagcttccttctacaaccctggcagtgatgctgtcatctaccctgcaccaacactggtgga
gaaagaagcagaggagaagaatcaagtgtaccccgaaattcgtgttcgaagactacatgaagctctatgctggcctcaag
ttccagcccaaagagccgcgattcgaggcgatgaa
back to top
>AB031027.1-ACO.m1960
atggagaacttcccaatcatcaacttggagggcctcaatggagagggaaggaaagcaacaatggaaaaaatcaaagatgc
ctgtgagaactggggcttctttgagcttgtgagtcatgggataccaactgagtttttggacacagtggagaggttgacta
aagaacactacaggcagtgcttggagcagaggttcaaggagctggtggccagcaagggccttgaggctgtcaagacagag
gtcaatgatatggactgggaaagcaccttctacttgcgccatcttccaaaatctaacatatctgaagttccagatcttga
ggatcagtacaggaatgtgatgaaggaatttgcattgaagttggagaaattagcagagcagctcctagacttgctctgtg
agaatcttggacttgaaaaagggtacctcaagaaggccttctatggaacaaatggaccaacttttggcaccaaggttagc
aactaccctccttgtcccaaccctgagctgatcaagggtctccgggctcacaccgatgcgggcggcctcatcctgctctt
ccaggatgacaaggtcagtggtctgcagctcctcaaggatggccaatggattgatgtgcctcccatgcgccactccattg
ttatcaaccttggtgaccaacttgaggtgatcactaacgggaagtacaggagcgtggagcacagagtgattgcccaaact
gatggcaccagaatgtcaatagcttccttctacaaccctggcagtgatgctgtcatctaccctgcaccaacactggtgga
gaaagaagcagaggagaagaatcaagtgtaccctaaattcgtgttcgaagactacatgaagctctatgctggcctcaagt
tccagcccaaagagccaagatttgaagccatgaaagcagtggaaaccaatatcagtttggtcccaattgcaacagcttaa
back to top