ACO, ACO (gene) Prunus persica

Gene Overview
Name ACO
Gene Symbol ACO
Type gene
Organism Prunus persica
Synonym ACC synthase
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
ACOAF239663.1-ACO.m1Prunus persicamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
1-aminocyclopropane-1-carboxylate oxidaseACOPrunus persicagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
mRNA parsed from NCBI nr database AF239663.1-ACO.m1 scaffold_7:19833143..19834463
AF239663.1

Sequence(s):
>AF239663.1-ACO.m11100
cagatggggttggcggagaatcaagtttcatttgatttgttggaaaagtacttggaagagcactcagaagcttccaaatg
gggatcaaaaggagtgccttgctttagagaaaatgccttgtttcaagattaccatggccttgtgtctttcagaaaggcaa
tggcaagtttcatgggacaaatcagaggaggaagagccaaatttgaccctgatagaattgtcctaactgcaggtgcaact
gcagccaatgagcttttaactttcattatagctgatcctggtgatgctttgcttgtgccaaccccatactatccgggatt
tgatagagatttaaggtggaggactggtgtgaatattgtaccaattcactgtgacagctcaaacaatttccagataactc
ctcaagctttggaagctgcatacaaagatgcagaagccaagaacatgagactgagaggggtactaatcacaaatccttca
aaccctttaggtgcaacaatccaaagagtagttcttgaagagattcttgattttgttacctccaaaaacatccatcttgt
ctctggtgaaatctattcggggtccaccttctcatcctctgcattcgtgagcattgcagagattcttgaagccaggcagt
acaagaattcagaaagagttcacattgtttatagcctttccaaagaccttggccttccgggatttagaattggcaccgtg
tactcgtacaatgacaaggttgtagcaacagcaagaaggatgtcaagcttcaccttaatatcttctcaaacacaacatct
cttggcttccatgttgtctgataaggaattcactgaaaattacataaagacaaacagagagagactgaggaagagatatg
atatgatcattgaagggttgaagaaagctgggattgagtgtttgaaaggaaatgctgggttgttttgctggatgaattta
agtccactcttagagaaaccaacaagaggaggtgaactggctctttgggactctatgctgcatgaagtgaagttaaatat
atctccaggctcttcttgccactgctctgaaccaggttggttccgcgtctgctttgccaa
back to top