ACO, ACO (gene) Pyrus communis

Gene Overview
Name ACO
Gene Symbol ACO
Type gene
Organism Pyrus communis
Synonym 1-aminocyclopropane-1-carboxylate oxidase
Description NA
Comment ACC oxidase; involved in ethylene biosynthesis
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
ACOAY728256.1-ACOPyrus communisgene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
ACOEU047710.1-ACO.m1Pyrus communismRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
1-aminocyclopropane-1-carboxylate oxidaseACOPyrus communisgene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database AY728256.1-ACO N/A AY728256.1
mRNA parsed from NCBI nr database EU047710.1-ACO.m1 N/A EU047710.1

Sequence(s):
>AY728256.1-ACO909
tctttttaaatttattttatttcaatatctaatcttaattttattttctaattttccatttccttttacacttatatgta
cttgtaaattcttctttaatagtgtattattttgctttagggggtgtattcaattgagaatttgagtttaattgatttgt
agagattccatataaaattttaattcaatttcctcgaaatctcatgagaagaggtgagatttgtgggatgcttaaattac
actacaaaatctctccaattccctttaattccttaactttctcaaattctttaaaatcaatttctaattgaatacacctg
gaatgttataaacttatttaaaatcctaattgaatacactcggatttctaaggattttaataaactatcttaaaattcta
attgatacatcttgaatttcagcgaatcacttaaaatcctgatcggaataccttttagattcatttaaaaagaattgaaa
aatcctctccaaaatccccaattgaatacatccccccccccttagtgtctacaattaccaaatttgaaagttggtacatg
gattctcatgttttgcatttagacagtgcatttacatttttgttatacaaaatttacatgtatcatgtgtaaatacaaat
gcttataatcgaaaatgacatgatgtatttttttttttcacttgttatactttaccatatataaatttggattaaattct
aatacggccataaatatttgaattttgataagatcacattcgacataaaagattatacaaaaaaatccaacttatttacg
gatctgccactctttagagcctataaattgcaccatagctataggtactcacactcaacaaaaacaaaggctacacacag
agcatacaaaccaagcaatccaaagagat
back to top
>EU047710.1-ACO.m1814
aaaagctgggtttctttgagttggttaagccatgggatatctactgagcttttggacattgtggagaagatgaccaagga
tcactacaagaagaccatggagcaaaggtttaaggaaatggtggcagccaaaggcctcgacgctgtccagtccgaaatcc
acgacttggactgggaaagcaccttcttcttgcgccaccttccttcctcaaacatttccgaagtccccgatctcgaggaa
gattacaggaagaccatgaaagaatttgcagtggaactggagaagctagctgagaagcttttggacttgctgtgtgagaa
ccttggactcgagaagggttatctgaagaaggttttctatggatccaagggtccgaattttgggaccaaggtcagcaact
accctccatgccccaagccagacctgatcaagggactccgggcccacagcgacgccggtggcatcatcctgcttttccag
gatgacaaggtcagcggcctccagcttctcaaggatggtgattgggtggatgtccccccaatgcaccactccattgtcat
aaacttaggtgaccagattgaggtgatcaccaatgggaagtacaagagtgtgatgcaccgggtgatagctcagtcggacg
ggaccagaatgtcgatagcctcgttctacaacccaggcgatgatgcatttatcagcccagcaccggcagtgcttgagaag
aaaactgaggacgccccaacttatcccaagtttgtgtttgaagactacatgaagctgtattctgggcctgaaattccaag
cccaaagaaccaag
back to top