ACO, ACO (gene) Pyrus pyrifolia

Gene Overview
Name ACO
Gene Symbol ACO
Type gene
Organism Pyrus pyrifolia
Synonym 1-aminocyclopropane-1-carboxylate oxidase
ACC oxidase
Description NA
Comment ACC oxidase
ACC oxidase; involved in ethylene biosynthesis
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
ACOEF600066.1-ACOPyrus pyrifoliagene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
ACOEU047709.1-ACO.m1Pyrus pyrifoliamRNA
ACOEF451060.1-ACO.m1Pyrus pyrifoliamRNA
ACOD67038.1-ACO.m1Pyrus pyrifoliamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
1-aminocyclopropane-1-carboxylate oxidaseACOPyrus pyrifoliagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database EF600066.1-ACO N/A EF600066.1
mRNA parsed from NCBI nr database EU047709.1-ACO.m1 N/A EU047709.1
mRNA parsed from NCBI nr database EF451060.1-ACO.m1 N/A EF451060.1
mRNA parsed from NCBI nr database D67038.1-ACO.m1 N/A D67038.1

Sequence(s):
>EF600066.1-ACO715
agcgttaataagttaaatgttagattagccactgatggggttcgaacccacgccatcatgcaaggacacaacatatttcc
accactgtataaatcaaacttgaaataattttgaaaaaatgcaaaagcaagagctaggcaccttccttccaaatcatttt
gaaggcactccaaacagatagaaagtgatagtgcggggtcctcagcatgcatgcaaattgaaccgtggggcaagccaaac
cccaattatttggtcaaagcgctaaaaaattggaaagatctgagcaagccagcaaccatggatggtgccgttgtggtcca
tattaccaaccaaagactcgagaagatatatagagaaggttttctctttttctttttcattttaggtagtgcaaagagaa
tattaagtagaacaatgcaaattaattttagcccatggatcgatccaaacatagtagatagtggggccacatgattatgc
tatttggatttgtttttttccttttagaatattagtttctttattataattcctcaagttacccttcactactgtacaaa
tagtttgcatgtttaactacaagaagttttattttttacgtttcgggtcattgctatctctataaatagcacaagcacca
aactccactccacaagaacaaattagccaaacacttgtagagagagaaagagttgagagagagagagagagagag
back to top
>EU047709.1-ACO.m1804
ttggtgaatcatgggatatctactgagcttttggacactgtggagaagatgaccaaggatcactacaagaagaccatgga
gcaaaggtttaaggaaatggtggcagccaaaggcctcgacgctgtccagtccgaaatccacgacttggactgggaaagca
ccttcttcttgcgccaccttccttcctcaaacatttccgaagtccctgatctcgaggaagattacaggaagaccatgaaa
gaatttgcagtggaactggagaagctagctgagaagcttttggacttgctgtgtgagaatcttggactcgagaagggtta
tctgaagaaggttttctatggatccaagggtacgaattttgggaccaaggtcagcaactaccctccatgccccaagccag
acctgatcaagggactccgggcccacagcgacgccggtggcatcatcctgcttttccaggatgacaaggtcagcggcctc
cagcttctcaaggatggtgaatgggtggatgtccccccaatgcaccactccattgtcataaacttaggtgaccagattga
ggtgatcaccaatgggaagtacaagagtgtgatgcaccgggtgatagctcagtcggacgggaccagaatgtcgatagcct
cgttctacaacccaggcgatgatgcctttatcagcccagcaccggcagtgcttgagaagaaaactgaggacgccccaact
tatcccaagtttgtgtttgatgactacatgaagctgtattctgggcctgaaattcccaagcccaaagaacccaaagatgg
aaaa
back to top
>EF451060.1-ACO.m1945
atggcgaccttcccagttgttgacttgagccttgtcaatggtgaagagagagtagcaaccttggagaagatcaatgatgc
ttgtgagaactggggtttctttgagttggtgaaccatgggatatctactgagcttttggacactgtggagaagatgacca
aggatcactacaagaagaccatggagcaaaggtttaaggaaatggtggcagccaaaggcctcgacgctgtccagtccgaa
atccacgacttggactgggaaagcaccttcttcttgcgccaccttccttcctcaaacatttccgaagtccctgatctcga
ggaagattacaggaagaccatgaaagaatttgcagtggaactggagaagctagctgagaagcttttggacttgctgtgtg
agaatcttggactcgagaagggttatctgaagaaggttttctatggatccaagggtccgaattttgggaccaaggtcagc
aactaccctccatgccccaagccagacctgatcaagggactccgggcccacagcgacgccggtggcatcatcctgctttt
ccaggatgacaaggtcagcggcctccagcttctcaaggatggtgaatgggtggatgtccccccaatgcaccactccattg
tcataaacttaggtgaccagattgaggtgatcaccaatgggaagtacaagagtgtgatgcaccgggtgatagctcagtcg
gacgggaccagaatgtcgatagcctcgttctacaacccaggcgatgatgcctttatcagcccagcaccggcagtgcttga
gaagaaaactgaggacgccccaacttatcccaagtttgtgtttgatgactacatgaagctgtattctggcctgaaattcc
aagccaaggaaccaagatttgaagctatgaaggccaaggaatcgacccctgttgcaactacctga
back to top
>D67038.1-ACO.m1945
atggcgaccttcccagttgttgacttgagccttgtcaatggtgaagagagagtagcaaccttggagaagatcaatgatgc
ttgtgagaactggggtttctttgagttggtgaaccatgggatatctactgagcttttggacactgtggagaagatgacca
aggatcactacaagaagaccatggagcaaaggtttaaggaaatggtggcagccaaaggcctcgacgctgtccagtccgaa
atccacgacttggactgggaaagcaccttcttcttgcgccaccttccttcctcaaacatttccgaagtccctgatctcga
ggaagattacaggaagaccatgaaagaatttgcagtggaactggagaagctagctgagaagcttttggacttgctgtgtg
agaatcttggactcgagaagggttatctgaagaaggttttctatggatccaagggtccgaattttgggaccaaggtcagc
aactaccctccatgccccaagccagacctgatcaagggactccgggcccacagcgacgccggtggcatcatcctgctttt
ccaggatgacaaggtcagcggcctccagcttctcaaggatggtgaatgggtggatgtccccccaatgcaccactccattg
tcataaacttaggtgaccagattgaggtgatcaccaatgggaagtacaagagtgtgatgcaccgggtgatagctcagtcg
gacgggaccagaatgtcgatagcctcgttctacaacccaggcgatgatgcctttatcagcccagcaccggcagtgcttga
gaagaaaactgaggacgccccaacttatcccaagtttgtgtttgatgactacatgaagctgtattctggcctgaaattcc
aagccaaggaaccaagatttgaagctatgaaggccaaggaatcgacccctgttgcaactacctga
back to top