ACO, ACO (gene) Pyrus x bretschneideri

Gene Overview
Name ACO
Gene Symbol ACO
Type gene
Organism Pyrus x bretschneideri
Synonym 1-aminocyclopropane-1-carboxylate oxidase
1-aminocyclopropane-1-carboxylate
Description NA
Comment ethylene biosynthesis; ACC oxidase
ethylene biosynthesis
ACC oxidase; involved in ethylene biosynthesis
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
ACOFJ389719.1-ACOPyrus x bretschneiderigene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
ACOEU333282.2-ACO.m1Pyrus x bretschneiderimRNA
ACOFJ389719.1-ACO.m1Pyrus x bretschneiderimRNA
ACOEU047708.1-ACO.m1Pyrus x bretschneiderimRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
1-aminocyclopropane-1-carboxylate oxidaseACOPyrus x bretschneiderigene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database FJ389719.1-ACO N/A FJ389719.1
mRNA parsed from NCBI nr database EU333282.2-ACO.m1 N/A EU333282.2
mRNA parsed from NCBI nr database FJ389719.1-ACO.m1 N/A FJ389719.1
mRNA parsed from NCBI nr database EU047708.1-ACO.m1 N/A EU047708.1

Sequence(s):
>FJ389719.1-ACO1576
atggcgaccttcccagttgttgacttgagccttgtcaatggtgaagagagagtagcaaccttggagaagatcaatgatgc
ttgtgagaactggggtttctttgaggtacgtaacccaacaagctgtgagatcttttatttttatccctcctcgaggcacc
aactagatgtcagcccctcgtgtgcttagagcggaaatctgtaaagtaaatctgtctctaagcgcaagggggtcggaaaa
caaatgcgccgccctagttgcccagttttatggtactgcgttagtttctgtagaattatgacatttctatgcgtttctaa
ctcttttttgtgtataaataactgaagttggtgaaccatgggatatctactgagcttttggacactgtggagaagatgac
caaggatcactacaagaagaccatggagcaaaggtttaaggaaatggtggcagccaaaggcctcgacgctgtccagtccg
aaatccacgacttggactgggaaagcaccttcttcttgcgccaccttccttcctcaaacatttccgaagtccctgatctc
gaggaagattacaggtcacacactaatcacaacaagcttaattaattttccacagaattggacttagtcaagttggctag
agcacccgtgcggcccctcgttgcattaagttcgaatctcctccatgtaggttaaattgtattagactatcgtgttgatt
ttcttgtatatattttgaacaatatttcaggaagaccatgaaagaatttgcagtggaactggagaagctagctgagaagc
ttttggacttgctgtgtgagaatcttggactcgagaagggttatctgaagaaggttttctatggatccaagggtccgaat
tttgggaccaaggtcagcaactaccctccatgccccaagccagacctgatcaagggactccgggcccacagcgacgccgg
tggcatcatcctgcttttccaggatgacaaggtcagcggcctccagcttctcaaggatggtgaatgggtggatgtccccc
caatgcaccactccattgtcataaacttaggtgaccagattgaggtatgccagttacctgactacccattttttatggaa
cggaagtccgatgcgtcatcaatatgtattgatatcattgtcgtcaacaaaacttacggacatgttaccaatacatttca
acgctcgaccaatttataatgaagagtggacgtcatgcacatataactaatactttcgctatcaagtttactgaatcgta
gactaattttgatgcaggtgatcaccaatgggaagtacaagagtgtgatgcaccgggtgatagctcagtcggacgggacc
agaatgtcgatagcctcgttctacaacccaggcgatgatgcctttatcagcccagcaccggcagtgcttgagaagaaaac
tgaggacgccccaacttatcccaagtttgtgtttgatgactacatgaagctgtattctggcctgaaattccaagccaagg
aaccaagatttgaagctatgaaggccaaggaatcgacccctgttgcaactacctga
back to top
>EU333282.2-ACO.m1945
atggcgaccttcccagttgttgacttgagccttgtcaatggtgaagagagagtagcaaccttggagaagatcaatgatgc
ttgtgagaactggggtttctttgagttggtgaaccatgggatatctactgagcttttggacactgtggagaagatgacca
aggatcactacaagaagaccatggagcaaaggtttaaggaaatggtggcagccaaaggcctcgacgctgtccagtccgaa
atccacgacttggactgggaaagcaccttcttcttgcgccaccttccttcctcaaacatttccgaagtccctgatctcga
ggaagattacaggaagaccatgaaagaatttgcagtggaactggagaagctagctgagaagcttttggacttgctgtgtg
agaatcttggactcgagaagggttatctgaagaaggttttctatggatccaagggtccgaattttgggaccaaggtcagc
aactaccctccatgccccaagccagacctgatcaagggactccgggcccacagcgacgccggtggcatcatcctgctttt
ccaggatgacaaggtcagcggcctccagcttctcaaggatggtgaatgggtggatgtccccccaatgcaccactccattg
tcataaacttaggtgaccagattgaggtgatcaccaatgggaagtacaagagtgtgatgcaccgggtgatagctcagtcg
gacgggaccagaatgtcgatagcctcgttctacaacccaggcgatgatgcctttatcagcccagcaccggcagtgcttga
gaagaaaactgaggacgccccaacttatcccaagtttgtgtttgatgactacatgaagctgtattctggcctgaaattcc
aagccaaggaaccaagatttgaagctatgaaggccaaggaatcgacccctgttgcaactacctga
back to top
>FJ389719.1-ACO.m1945
atggcgaccttcccagttgttgacttgagccttgtcaatggtgaagagagagtagcaaccttggagaagatcaatgatgc
ttgtgagaactggggtttctttgagttggtgaaccatgggatatctactgagcttttggacactgtggagaagatgacca
aggatcactacaagaagaccatggagcaaaggtttaaggaaatggtggcagccaaaggcctcgacgctgtccagtccgaa
atccacgacttggactgggaaagcaccttcttcttgcgccaccttccttcctcaaacatttccgaagtccctgatctcga
ggaagattacaggaagaccatgaaagaatttgcagtggaactggagaagctagctgagaagcttttggacttgctgtgtg
agaatcttggactcgagaagggttatctgaagaaggttttctatggatccaagggtccgaattttgggaccaaggtcagc
aactaccctccatgccccaagccagacctgatcaagggactccgggcccacagcgacgccggtggcatcatcctgctttt
ccaggatgacaaggtcagcggcctccagcttctcaaggatggtgaatgggtggatgtccccccaatgcaccactccattg
tcataaacttaggtgaccagattgaggtgatcaccaatgggaagtacaagagtgtgatgcaccgggtgatagctcagtcg
gacgggaccagaatgtcgatagcctcgttctacaacccaggcgatgatgcctttatcagcccagcaccggcagtgcttga
gaagaaaactgaggacgccccaacttatcccaagtttgtgtttgatgactacatgaagctgtattctggcctgaaattcc
aagccaaggaaccaagatttgaagctatgaaggccaaggaatcgacccctgttgcaactacctga
back to top
>EU047708.1-ACO.m1835
ttttgtgagaaacttaggtttctttgagttggtgaaccatgggatatctactgagcttttggacactgtggagaagatga
ccaaggatcactacaagaagaccatggagcaaaggtttaaggaaatggtggcagccaaaggcctcgacgctgtccagtcc
gaaatccacgacttggactgggaaagcaccttcttcttgcgccaccttccttcctcaaacatttccgaagtccctgatct
cgaggaagattacaggaagaccatgaaagaatttgcagtggaactggagaagctagctgagaagcttttggacttgctgt
gtgagaatcttggactcgagaagggttatctgaagaaggttttctatggatccaagggtccgaattttgggaccaaggtc
agcaactaccctccatgccccaagccagacctgatcaagggactccgggcccacagcgacgccggtggcatcatcctgct
tttccaggatgacaaggtcagcggcctccagcttctcaaggatggtgaatgggtggatgtccccccaatgcaccactcca
ttgtcataaacttaggtgaccagattgaggtgatcaccaatgggaagtacaagagtgtgatgcaccgggtgatagctcag
tcggacgggaccagaatgtcgatagcctcgttctacaacccaggcgatgatgcctttatcagcccagcaccggcagtgct
tgagaagaaaactgaggacgccccaacttatcccaagtttgtgtttgatgactacatgaagctgtattctggcctgaaat
tccaagccaaagaaccaaggttgaaagctttgaaa
back to top