ACO, ACO (gene) Rosa hybrid cultivar

Gene Overview
Name ACO
Gene Symbol ACO
Type gene
Organism Rosa hybrid cultivar
Synonym 1-aminocyclopropane-1-carboxylate oxidase
Description NA
Comment ACO
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
1-aminocyclopropane-1-carboxylate oxidaseACORosa hybrid cultivargene_class


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
ACOAF441282.1-ACO.m1Rosa hybrid cultivarmRNA


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
mRNA parsed from NCBI nr database AF441282.1-ACO.m1 N/A AF441282.1

Sequence(s):
>AF441282.1-ACO.m1831
gcttgtgaaaactggggttttttcgagttggtgaaccatgggatatcccatgagctgatggacaaggtagagaagctcac
aaaggagcactacagaaagtgcgtggagcaaaggttcaaggaaatggtggcaagcaaaggcctcgaatctgtcaactctg
aaatcgaagatttggactgggaaagcaccttcttcttgcgccacctccccttctccaacatttcccaaatccccgatctc
gacgaagattacagggaggccatgaaggaatttgcagtggaactagagaaactggctgagaaactgttggacttgctgtg
tgagaatctggggctggataagggttacctgaagaaggctttctatggatccgagggaccaaattttgggaccaaggtga
gcaactaccctccatgccccaaaccggacctgatcaagggactccgggcccacaccgacgccggtggcatcatcctacta
ttccaagatgacaaggtcagcggcctccagctcctcaaggatgaccaatggattgatgtgccaccaatgcaccactccat
tgtcatcaacttaggtgaccaacttgaggtgattactaatggcaagtacaagagtgtgatgcaccgtgtgatagcgcaac
ctgatggaaacagaatgtcgatagcctcgttctacaacccaggcaatgatgcttttatctctccagcaccagcaatgctt
gaaaaacagactgaggaatgcccaacttatccaaaatttgtgtttgatgactacatgaagctctatgcaggcctcaaatt
ccaagccaaggaaccgcggttcgaggcgatg
back to top