ACO, ACO (gene) Rosa roxburghii

Gene Overview
Name ACO
Gene Symbol ACO
Type gene
Organism Rosa roxburghii
Synonym 1-aminocyclopropane-1-carboxylate oxidase
Description catalyzes conversion of ACC to ethylene which is a prominent step in ethylene biosynthetic pathway in plants
Comment ACC oxidase
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
1-aminocyclopropane-1-carboxylate oxidaseACORosa roxburghiigene_class


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
ACODQ077712.1-ACO.m1Rosa roxburghiimRNA


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
mRNA parsed from NCBI nr database DQ077712.1-ACO.m1 N/A DQ077712.1

Sequence(s):
>DQ077712.1-ACO.m1632
aactggggtttttttgagctggtgaatcatgggctacccattgagcttctggacacagtggagaagatgacgaaaggcca
ctacaagaattgtttggagcaaagatttaaggagctggtggccagcaaaggccttgaggcagttaacactgaggtcaaag
acatggactgggagagcaccttccacctgaagcaccttccccactcaaacatctcagaagtcccagatctcgaggacgag
tacaggaaggtcatgaaggagtttgctctgaaactggagaagctagcggaggagctcttggacttgttctgtgagaatct
tggactggaaaaagggtacctcaagaaggtcttctatggttcacagggtagtcctacctttggcaccaaggtcagcaact
accctccgtgccccaccccggacctcatcaagggtctccggtcccacaccgacgccggcggcatcatccttctcttccag
gatgacaaggtcagtggccttcagctcctcaaggacggtaaatgggttgatgtacccccaatgcgccactccattgttat
caaccttggtgaccaacttgaggtgattactaatgggaagtacaagagtgtggagcaccgagtgattgccca
back to top