ADC, ADC (gene) Malus hupehensis

Gene Overview
Name ADC
Gene Symbol ADC
Type gene
Organism Malus hupehensis
Synonym arginine decarboxylase
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
arginine decarboxylaseADCMalus hupehensisgene_class


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
ADCEU431331.1-ADC.m1Malus hupehensismRNA


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
predicted genes from whole genome assembly EU431331.1-ADC.m1 Chr05:9464564..9466751
unanchored:7183816..7186003
EU431331.1

Sequence(s):
>EU431331.1-ADC.m12187
atgacggccctggcttgttgcgtggatgctgctgtggcgcctctaggccacgctttcgccggggatagctctcttcccgc
gtcgccgttcccaagcttacctccggcgaccatcaccaccgccgccgacaattcccattggtctccttccctctcgtccg
acctctaccgaatagacgcctggggtgggccctacttcaccgtcaactcctccggcaacgtcgccgtccgtcctcacggg
acggcgactctgccgcaccaggagattgatctgctgaagatcgtgaagaaggtttcggattcaaaaccggagtgcggact
tgggttgcagctgccgctcattgttcgcctccctgatgtgctcaaggaccggctcgagtccctccagggcgccttcgatc
tggcgatccggtcccacgactacggctcccactaccagggcgtgtacccggtgaaatgcaaccaggaccggttcgtcgtg
gaggacattgtcaagttcgggtccccgttccggttcggactggaagccgggtcgaagccggagctcctcttggccatgag
ctgcttgtgcaaaggtaatcccgacgcccttctcatctgcaatggattcaaagaccttgagtacatctctctggctctgt
tcgcccgcaagctcgccttgaacactgtgattgttcttgagcaagaggaggagctcgatttggttgtcgatttcagccaa
aagctcggcgtacgacccgtgattggtgtccgggccaagctcaagaccaagcattcgggccattacggttcgacttccgg
cgagaagggaaagttcggactcaccaccactcagattttacgcgttgtgaagaagcttgataagctgggtatgcttgatt
gctttcagttgttgcattttcatatcgggtctcagatcccttcgacggccctgctcgctgatggcgtatccgaggcatcg
cagatatattgcgaattggtccgtctcggtgcccacatgaaggtcatagacattggaggcggtctgggtattgattacga
tggatccaaatctagtgactcggagatttctgtcagctacggccttgaagagtatccctccgccgttgtccgaacggttc
ggaacgtctgtgaacggaggtccgtgaagcacccggtgatttgcagtgaaagcggccgagccttggtttcccaccactcg
gttctcatatttgaggctatttcttccagtgcttgtgatgatgctcctcccatgtccgcctttgagcatcagtacttcat
tgagggtctgacggatgaagctcgtgccgattacctgaacctctccgctgcggctatcagaggtgagtacgaggcttgtt
tgacgtatgctgatctgttgaaacaacggagtgttgaacaattcaaagaagggtctgtcggtattgagcaattagccacc
gtcgatgggttctgtgatatgctttcgaaagcaatcggggcatctgacgctgtccgtacataccatgtgaatctctcggt
atccacttcaattccagacttctggggtattgggcagacgttccccatagtcccgattcaccgcctcgatcaacggccgg
cagtgaggggagtattgtcagacttgacctgtgacagtgatgggaaaatcgacaagttcattggcggcgggtctagcttg
ccgctgcatgagctggaaggcaatggtgggaataatggcggtgggcaaaagtactatttggggatgttcctgggcggggc
ttatcaggaggcgctcggaggagtccacaacctcttcggtggcccgagcattgttcgggtttcgcagagcgatggtcccc
acagcttcgcggtgacgggagctgtgtcaggtccgtcatgtggggacgtcctgcgggtgatgcagcatgagcccgagctc
atgtttgagacgctgaagcaccgcgcggaggagtgcgggcagggtgacgatgggggaatggccagtgccgctgtggccac
cagcctggcccggtccttccacaacatgccgcacctggtgtcagcttcttcttgtagcctgactgcaatgaataaccatg
ggttctactattgcagcgaggatgattacgacgacattgttgccgattcggcgggggctgctgctcccgttggcgaggaa
gaacagtggtcttattgctgtgcttaa
back to top