ADC, ADC (gene) Prunus persica

Gene Overview
Name ADC
Gene Symbol ADC
Type gene
Organism Prunus persica
Synonym arginine decarboxylase
pPpADC
PpADC
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
arginine decarboxylaseADCPrunus persicagene_class


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
ADCAB194102.1-ADC.m1Prunus persicamRNA
ADCAB379849.1-ADC.m1Prunus persicamRNA


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
mRNA parsed from NCBI nr database AB194102.1-ADC.m1 scaffold_8:10891658..10892851
AB194102.1
mRNA parsed from NCBI nr database AB379849.1-ADC.m1 scaffold_8:10891105..10893283
AB379849.1

Sequence(s):
>AB194102.1-ADC.m11211
taccagggtgtatatccggtgaaatgcaaccaggaccggttcgttgtggaggacattgtccggttcggctcgccgttccg
gttcggattggaagctgggtcgaagccggagcttctcttggccatgagctgcttgtgcaaaggtaacccagaagcccttc
tcatctgcaatggattcaaagacttcgagtacatctctctggctctgtttgctcgcaagctcgccttaaacacagtgatt
gttcttgagcaagaggaagagctcgatgtggttatcgatttgagcaagaagctaggtgttcgacccgtgattggggcccg
agccaagctcaaaaccaagcattcgggtcatttcgggtcgacttcgggcgagaaagggaagttcgggctcactaccactc
agattttacgggttgttaagaaacttgatcaattgggtctgcttgattgctttcagttgttgcatttccatattgggtct
cagatcccttcgactgctctgctcgccgatggcgtatccgaagctgctcagatctactgtgaattggtccgcctcggtgc
ccacatgaagttcatagacattggaggcggtctgggtatcgattacgatggatccaaatccagtgactctgagatttcag
tcagctatagcctcgaagagtatgctgccgctgttgtccgagcagtcctgaacgtttgtgaccggaagtcggtgaagcac
ccggtgatttgcagcgaaagtggccgagccctcgtgtctcaccactcggttatgatatttgaggccatttcttccagcgc
ctgtgatgatgttcctcccatgtctgcgtttgcgcttcagtatttcatcgaggggctcacagaggaagctcgtgccgatt
accgaaacctctcggctgcggcaatcagaggtgagtatgaggcttgcttgacatatgctgatcagttgaaacaacgctgt
attgatcagttcaaagaagggtctctgggcattgagcaattagccactgttgatgggctttgtgatatggtttcgaaagc
aatcggggcatctgaccctgtccgtacgtaccatgtgaatctctcggtttttacttcaattccagacttctggggcattg
ggcagacgttcccaatagtcccgattcaccgcctcgatcagcggccggcggtgagggggatattgtcggacttaacatgt
gacagcgacgg
back to top
>AB379849.1-ADC.m12178
atgccggccctggcttgttgcgtggacgctgctgtggctcctcccggctacgccttcgccggggatagctctcttcccgc
gccgccattttccggcgtacctccggcgaccaccgccgtcaccactgacagttcccattggtctccctccctgtcatccg
acctctaccgaatcgacgcctggggtgggccctacttcaccgtcaattcctccggcaacgtctccgtccgtccgcacggg
tcggcgaccctgccccaccaggagatcgatctgctgaagatcgtgaagaaggtttcggatccgaaaccagattgcgggct
cgggttgcagctcccgctcattgttcgcctgcccgatgtgctcaagaaccggctggagtcgctccagggggcgttcgatc
tcgcgatccagtctcacgactacgggtcccactaccagggcgtgttcccggtgaaatgcaaccaggaccggttcgttgtg
gaggacattgtccggttcggctcgccgttccggttcggattggaagctgggtcgaagccggagcttctcttggccatgag
ctgcttgtgcaaaggtaacccagaagcccttctcatctgcaatggattcaaagacttcgagtacatctctctggctctgt
ttgctcgcaagctcgccttaaacacagtgattgttcttgagcaagaggaagagctcgatgtggttatcgatttgagcaag
aagctaggtgttcgacccgtgattggggcccgagccaagctcaaaaccaagcattcgggtcatttcgggtcgacttcggg
cgagaaagggaagttcgggctcactaccactcagattttacgggttgttaagaaacttgatcaattgggtctgcttgatt
gctttcagttgttgcatttccatattgggtctcagatcccttcgactgctctgctcgccgatggcgtatccgaagctgct
cagatctactgtgaattggtccgcctcggtgcccacatgaagttcatagacattggaggcggtctgggtatcgattacga
tggatccaaatccagtgactctgagatttcagtcagctatagcctcgaagagtatgctgccgctgttgtccgagcagtcc
tgaacgtttgtgaccggaagtcggtgaagcacccggtgatttgcagcgaaagtggccgagccctcgtgtctcaccactcg
gttatgatatttgaggccatttcttccagcgcctgtgatgatgttcctcccatgtctgcgtttgcgcttcagtatttcat
cgaggggctcacagaggaagctcgtgccgattaccgaaacctctcggctgcggcaatcagaggtgagtatgaggcttgct
tgacatatgctgatcagttgaaacaacgctgtattgatcagttcaaagaagggtctctgggcattgagcaattagccact
gttgatgggctttgtgatatggtttcgaaagcaatcggggcatctgaccctgtccgtacgtaccatgtgaatctctcggt
ttttacttcaattccagacttctggggcattgggcagacgttcccaatagtcccgattcaccgcctcgatcagcggccgg
cggtgagggggatattgtcggacttgacctgcgacagtgatgggaagattgacaagttcatcggtggcgagtcgagcctg
ccgctgcatgaattggaaggtaatggtggggctagtggcggtgggcagaagtactatctggggatgttcttgggcggggc
ttatcaggaggcactcggaggcgtccacaacctgtttggaggcccgagcgttgttcgggtctcccagagcgatggacccc
acagctttgcggtaacgctggctgtgccagggccgtcgtgttcggatgtccttcgagtgatgcagcatgagcccgagctc
atgttcgagacactgaagcaccgtgcggaggagtacgggcagggcgacgatggcggcatggctagcgccgcagtcgccac
cagccttgcccgctccttccacaacatgccgtatctggtggcagcttcatcgtgttgcttgactgcaatgaacaaccatg
gcttgtactattgcagtgaggatgattatgacgttgttgcagattctgctggtggtggtggtggtgaggaagatcagtgg
tcttactgctgtgcttga
back to top